ID: 1012001906

View in Genome Browser
Species Human (GRCh38)
Location 6:93664456-93664478
Sequence GACAGCTTTTAACCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012001905_1012001906 12 Left 1012001905 6:93664421-93664443 CCTACTATCTTCTGCAAATATCT No data
Right 1012001906 6:93664456-93664478 GACAGCTTTTAACCTGTTACTGG No data
1012001904_1012001906 13 Left 1012001904 6:93664420-93664442 CCCTACTATCTTCTGCAAATATC No data
Right 1012001906 6:93664456-93664478 GACAGCTTTTAACCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012001906 Original CRISPR GACAGCTTTTAACCTGTTAC TGG Intergenic
No off target data available for this crispr