ID: 1012002038

View in Genome Browser
Species Human (GRCh38)
Location 6:93665554-93665576
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1114
Summary {0: 21, 1: 125, 2: 197, 3: 181, 4: 590}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012002030_1012002038 24 Left 1012002030 6:93665507-93665529 CCAGGATCTTGGAAGGAGCATGA No data
Right 1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG 0: 21
1: 125
2: 197
3: 181
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012002038 Original CRISPR CTGGGGAAGAGGTATGTGGA TGG Intergenic
900421215 1:2556790-2556812 ATGGGGAAGAGATCTGTGGGAGG - Intronic
900798061 1:4721295-4721317 AGGCGGAAGAGGTATGTGGTGGG - Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901903831 1:12391018-12391040 TTTGGGAATAGGTATGTGGATGG - Intronic
903530475 1:24026464-24026486 CTGGGGTAGAGGGCTGTGGTGGG + Intergenic
903671657 1:25039503-25039525 CTGGGCCAGAGGTTTGTGGTTGG + Intergenic
903848266 1:26291132-26291154 CTGGGGTGGAGGCCTGTGGAGGG - Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904179400 1:28655314-28655336 TTGGGAAAGAGGTATGTGGATGG - Intergenic
904269032 1:29337008-29337030 CTGCAGAAGAGTCATGTGGATGG + Intergenic
904336024 1:29798644-29798666 TTGGGGAAGAGATATGTGGATGG + Intergenic
904419475 1:30382404-30382426 GTGGGGAAGAGGTGTGTAGCTGG - Intergenic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905256547 1:36688764-36688786 AAGGGGAAGAGGTGTGTGAAGGG + Intergenic
905327004 1:37160302-37160324 CTGGGAAATAGTCATGTGGAAGG + Intergenic
905343567 1:37295797-37295819 CTGGGGAAGTAGTAAGTGGGAGG + Intergenic
905354162 1:37369438-37369460 CTGAGGAAGAGGTATATGGATGG + Intergenic
905465315 1:38148759-38148781 TTGGGGACGAGGTATGTGGATGG + Intergenic
905818222 1:40968530-40968552 TTGGGGAAGTGGTAATTGGAAGG + Intergenic
905914996 1:41678544-41678566 CTGGGGAAGAGGTGTGTGGGTGG - Intronic
906175434 1:43767308-43767330 CAGGGGAAGATGGATGTGGCTGG + Intronic
906725806 1:48043351-48043373 CTTGGGAAGATTAATGTGGAAGG - Intergenic
906879752 1:49577110-49577132 TTGGGGACAAGGTATGTGGATGG + Intronic
906930831 1:50167853-50167875 TTTGGGGAGAGGTATGTGGATGG - Intronic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907597435 1:55732779-55732801 TTGGGGAAGAGGTATGTGGATGG + Intergenic
908192679 1:61719454-61719476 CTGGGTAAAGGGTATATGGATGG + Intronic
908220267 1:61999124-61999146 CTGGGGAAGAAATTTATGGAAGG + Intronic
908737472 1:67291469-67291491 TTGGGGAAGAGGTATGTGGATGG + Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909172901 1:72317729-72317751 CTGGAGAAGAGGCATGGGAATGG - Intergenic
909548859 1:76876527-76876549 TTAAGGAAGAGGTATGTGGATGG - Intronic
909577018 1:77186514-77186536 TTGGGGAAGAGGTATGTGGATGG + Intronic
910370724 1:86512787-86512809 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910588302 1:88902380-88902402 TTGGGGAAGAGGTATGTTGATGG + Intergenic
910630307 1:89346922-89346944 TGGGGGAACAGGTATGTGGATGG + Intergenic
910638896 1:89439318-89439340 ATGGGGAAGAGGTATATGGATGG - Intergenic
910790422 1:91044399-91044421 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910831010 1:91462765-91462787 TTGGGGAAGAGGCATGTGGATGG - Intergenic
910844511 1:91592570-91592592 CTGGGGAGGAGGTGCATGGAAGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911257247 1:95646706-95646728 TTGGGGAAGAGGTATGTGGATGG - Intergenic
911738306 1:101361275-101361297 CTGGGGAAGAGGTATGTGGCTGG - Intergenic
911883663 1:103271119-103271141 TTGAGGAAGAGGCATGTGGATGG + Intergenic
911980513 1:104560074-104560096 CTGGGGAAGAGGTATGCAGATGG + Intergenic
911981819 1:104578608-104578630 TTTGGGAAAAGGTATGTGTATGG - Intergenic
912050606 1:105524294-105524316 CTTGGGAAGAGGAATGCAGATGG - Intergenic
912050963 1:105527216-105527238 CTGGAGAACAGGCATGGGGATGG - Intergenic
912066730 1:105754323-105754345 CTGGAGAACAGGTATGAGAAAGG + Intergenic
912067108 1:105757612-105757634 TTGGGGAAGAAGTATGTGGTTGG + Intergenic
912129823 1:106587400-106587422 GTAGGGAAGAGGTATGTGGATGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912733237 1:112128170-112128192 TTGGGGAAAATGTATGTAGATGG - Intergenic
913039356 1:115007742-115007764 TTGGGGAAGAGGTATATGGATGG - Intergenic
914801956 1:150968513-150968535 CTGGGGAAGGGATATGAGTAAGG + Intronic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915456375 1:156043630-156043652 CTGGGGGAAAGGGATGTGCAGGG - Intronic
915551060 1:156634676-156634698 CCAGGGAAGAGGTATATGGATGG - Intergenic
915603500 1:156937059-156937081 CTGGGGAAGGGGTCTGTGCTGGG + Intronic
915667589 1:157459015-157459037 GTGGGGAAAGGGTATATGGATGG - Intergenic
915667965 1:157461924-157461946 CTGGAGAACAGGTATGGGAATGG - Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916648692 1:166815446-166815468 ATAGGGAAGAGGCATGTGAATGG + Intergenic
917217132 1:172690255-172690277 TTGGGGAAGAGGTATGTGGATGG - Intergenic
917313722 1:173703527-173703549 CTGAGGTAGAGGCATGTGAATGG - Intergenic
917462790 1:175246813-175246835 GTGGGGAAGAGGTATATGGATGG + Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917802074 1:178580563-178580585 CTGAGGAGGAGGGATGGGGAGGG - Intergenic
918755618 1:188337151-188337173 TTGGGCAAGAGGTATGTGGATGG - Intergenic
918774581 1:188611406-188611428 CTAGGGAAAAGGTTTGTGGGTGG + Intergenic
918783375 1:188731914-188731936 TTGGGGAAGACTTATGAGGATGG - Intergenic
918918141 1:190671222-190671244 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
918958321 1:191238589-191238611 CTGGGCAAGAGGTATGTGGATGG + Intergenic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
919230306 1:194764830-194764852 CTGGAGAATAGGCATGGGGATGG - Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919318061 1:195999986-196000008 TTGGGGAAGAGATATGTGGATGG + Intergenic
919616704 1:199816851-199816873 CTGAAGAAGAGATATTTGGAGGG + Intergenic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920197524 1:204239024-204239046 TTGGGGAAGAGGTATGTGGATGG + Intronic
920232689 1:204481053-204481075 CAGGGGGAAAAGTATGTGGAGGG - Intronic
921091409 1:211847367-211847389 CTAGGGAACAGGTAAGTTGAAGG - Intergenic
921193489 1:212730296-212730318 CTGGTGAAGAGTTGTGTGGAGGG + Intronic
921720889 1:218469824-218469846 CTGGGGAAAAGATTTGTCGATGG + Intergenic
922009597 1:221568935-221568957 CTGGGGTAGAAGTATGCAGAGGG + Intergenic
922035734 1:221846158-221846180 CTTGGGAAGAGGTGAGGGGAGGG + Intergenic
922207342 1:223459979-223460001 CTGGGGAAGAGGAAACTGCAAGG - Intergenic
922228507 1:223665952-223665974 CTTGCAAAGAGGTGTGTGGAGGG - Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922597420 1:226824582-226824604 CAGGAGATGAGGAATGTGGATGG - Intergenic
922770852 1:228182374-228182396 GTGGGGACGAGGTGTGTGGTGGG + Intergenic
922780959 1:228251940-228251962 TTGAGGAAGAGGTGTGTGGATGG - Intronic
922883064 1:228997150-228997172 CTGGGGAAGTGGCATGGGGTAGG + Intergenic
922952846 1:229573702-229573724 CTGGGGAAAAGGCATTTGGGTGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923253487 1:232198794-232198816 TTGGGGAAGAAGTATGTGGATGG - Intergenic
924829598 1:247579052-247579074 CTGGGGAAGAATTATGTGGATGG + Intergenic
924840684 1:247707178-247707200 CTGGGGAGGAGGCATGTGGGTGG - Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063359402 10:5439047-5439069 TTGGAGAAGAGGCATATGGATGG - Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1065143601 10:22744017-22744039 TGGGGGAAGAGGTGTATGGAAGG + Intergenic
1066166936 10:32798572-32798594 TTGGGGAAGAGGTATGTGGATGG - Intronic
1066169522 10:32826977-32826999 TTGGGGAAGAGGTATGTGGGTGG + Intronic
1067125461 10:43511890-43511912 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1067143144 10:43673032-43673054 CAGAGGAAGAGGTAGGTGGTTGG - Intergenic
1067333228 10:45340875-45340897 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068007581 10:51408924-51408946 CTGGGGAAGAGGTGTGTGGATGG - Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068837127 10:61567724-61567746 TTGGGGAAGAGATATATGGATGG - Intergenic
1068856523 10:61803572-61803594 CTGGGGAAGAAGTATGTCAGCGG - Intergenic
1069192218 10:65505714-65505736 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1069790742 10:71018926-71018948 TTTGGGAAGAGGTATGTGGATGG - Intergenic
1070258141 10:74827442-74827464 ATGGGAAAGAGGTATCTGGGTGG + Intronic
1071032837 10:81205371-81205393 TCGGGGAAGAGGTATGTGGATGG + Intergenic
1071266988 10:83973348-83973370 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1071476348 10:86028660-86028682 CTGGCTAAGAGGTATGCTGAGGG - Intronic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071673828 10:87636771-87636793 CTTGGGAAGAGGTATGTGTGTGG - Intergenic
1071937776 10:90549934-90549956 TTGGGGACGAGGTATGTGGACGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073557440 10:104466549-104466571 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1073634837 10:105187205-105187227 GGGGGGAAGAGGTGGGTGGAAGG - Intronic
1073656596 10:105423836-105423858 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074689953 10:115995275-115995297 CTGGTGGAGGGGTAAGTGGACGG + Intergenic
1074780524 10:116798942-116798964 CTGCGGAGGATGTCTGTGGATGG - Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075439530 10:122468504-122468526 CTGGGGATGAGGTGGGTGGGTGG + Intronic
1075606879 10:123818061-123818083 TTCGGGAGGAGGTATGTGGATGG + Intronic
1075808805 10:125209387-125209409 CTGAGCTAGAGGAATGTGGAAGG - Intergenic
1075880878 10:125849652-125849674 CTGCGGCAGAGCTATGGGGAGGG + Intronic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076548267 10:131260445-131260467 CTGCGGAAGAGGGATGCAGAGGG + Intronic
1076846447 10:133071731-133071753 CTGGGGAAGGAGTGTGTGGCTGG - Intronic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077791832 11:5449434-5449456 CTGGGCAAGGGGTATGGTGAGGG + Intronic
1078288345 11:9981221-9981243 CTGGGGAAGATGTATTTTTAAGG - Intronic
1078700578 11:13677797-13677819 TTTGGGAAGAGCTATATGGATGG + Intronic
1078799360 11:14627439-14627461 CTGGGTAAAAGTTATCTGGATGG + Intronic
1079709797 11:23666771-23666793 CTGGGGTAGGGGTAAGTGAAAGG - Intergenic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080076690 11:28158148-28158170 TTGGGGAACAGGTATGTGGATGG + Intronic
1080316721 11:30958223-30958245 TTGAGGAAAAAGTATGTGGATGG + Intronic
1080428658 11:32178763-32178785 TTAGGGAAGAGGTGTGTGCAGGG - Intergenic
1080783794 11:35455932-35455954 CTGGGGAATAAGTAAGTGGAAGG - Intronic
1081065376 11:38534248-38534270 TTGGGAAAGAGGTATCTGAATGG - Intergenic
1081072878 11:38631827-38631849 TTGGGGATGAGTTATGTGGATGG + Intergenic
1081524589 11:43917596-43917618 CTGGGGAAAAGATATCCGGAGGG - Intronic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1082086884 11:48057653-48057675 CTGGGGGAGAACTGTGTGGAGGG + Intronic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1082999749 11:59280497-59280519 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
1083093231 11:60221758-60221780 TTTGGGAAGAGGTATGTGAATGG + Intronic
1083178164 11:60965939-60965961 CTGGGGTAGAGGCATGTGGATGG + Intergenic
1083186111 11:61018862-61018884 GTGGGGAAAATGGATGTGGACGG + Intronic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1083507977 11:63178452-63178474 CTGGGGAAGATGCATATAGAGGG - Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084921629 11:72475459-72475481 CTGGAGAAGAGATACGTAGATGG + Intergenic
1084958711 11:72704753-72704775 CTGGGCAAGAGGGATGGGGGTGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085684759 11:78611497-78611519 TTGAGGAAAAGGTATGTGAATGG + Intergenic
1085686047 11:78622822-78622844 CTGGGGGAGAGGTATGTGGATGG + Intergenic
1085794003 11:79520221-79520243 GTGGGGGAGAGGTATGAAGATGG + Intergenic
1085996685 11:81925149-81925171 CTGGGGTAGAGGTGTTTGGGAGG + Intergenic
1086141547 11:83505571-83505593 TTGGGGAAGAGGTATATGGATGG - Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086834208 11:91601024-91601046 TTTGGGAAGACGTATGTGGATGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086870987 11:92036376-92036398 CTAGGGAACAGACATGTGGATGG - Intergenic
1088097297 11:106115789-106115811 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1088449441 11:109966000-109966022 TTGGGGAAGAGGTATATGGATGG + Intergenic
1088553457 11:111037805-111037827 CTGGGGGTGAGACATGTGGATGG - Intergenic
1088836748 11:113584021-113584043 TTGAGAAAGAGGTATGTGGACGG + Intergenic
1089145804 11:116329032-116329054 CTGGGCCAGAGGTGTGGGGAAGG - Intergenic
1089375005 11:117987982-117988004 GTGGGGATCAGGTGTGTGGATGG + Intronic
1089416999 11:118300514-118300536 CTGGGGAAGATGCACGTGTATGG + Intergenic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090209404 11:124907423-124907445 TTTGGGAAGAGGTATGTGGATGG - Intergenic
1090221524 11:125030968-125030990 CTGGGGAAGAGTTATGTGGACGG - Intronic
1090866900 11:130709423-130709445 CTGGGGAAAATGTAAATGGATGG + Intronic
1091051830 11:132379388-132379410 TTGGGGAAAAGGTATGTGGAAGG + Intergenic
1091311836 11:134580441-134580463 CTGGAGCAGAGGTCTGTGGGTGG + Intergenic
1091712517 12:2752116-2752138 CTGGGAAAAAGGCATGTGAAGGG - Intergenic
1091790228 12:3267979-3268001 TTGGGGAAAAGGCATGTCGAAGG + Intronic
1092093370 12:5822282-5822304 CTGGGGAAGAGGTATGTAGATGG + Intronic
1092380980 12:7996904-7996926 CTGGAGAAGAGGTATGGGAACGG + Intergenic
1092403718 12:8200011-8200033 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1093031776 12:14295303-14295325 CTGGGGAAGAGGTATGTGGGTGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093387369 12:18574534-18574556 TTGGGGCAGTGGTATGGGGAGGG - Intronic
1093412578 12:18884212-18884234 CTGGGGAATATATATGTGAATGG + Intergenic
1093645809 12:21584303-21584325 TTGGGGAAGAGGTATGTGGATGG + Intronic
1094059026 12:26293811-26293833 CTGAGAAAGAGGCATGTGAATGG + Intronic
1094102619 12:26779895-26779917 TTGGGGAAGAGGTATGTAGACGG + Intronic
1094389706 12:29935591-29935613 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1094427073 12:30327169-30327191 CTGAAGAAAAGGTATGTGGAAGG - Intergenic
1095121426 12:38424207-38424229 TTAGGGAAGAGATATGTGGATGG - Intergenic
1095442907 12:42255794-42255816 CTAAGGAAGAGGTATGTGGGTGG - Intronic
1095603940 12:44044967-44044989 TTGGGGAAGAGATATGTGGATGG + Intronic
1095732273 12:45519053-45519075 ATGAGGAAGAGCAATGTGGAAGG - Intergenic
1095839358 12:46675443-46675465 TTGGGGATGAGGGAAGTGGAGGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095856158 12:46863044-46863066 TTGGGGAAGAAATATGTGGATGG - Intergenic
1095947276 12:47760408-47760430 ATGGGGAAGAGTTAGGGGGATGG + Intronic
1096288854 12:50323882-50323904 TTGGGGAAGAGATATGTGGATGG + Intergenic
1096381253 12:51159879-51159901 ATGGGGCTGAGGGATGTGGATGG + Intronic
1096457374 12:51798816-51798838 TTGGGGAAGAGGTATGTGGATGG - Intronic
1096457790 12:51801717-51801739 CTGGAGAACAGGTATGGGAATGG - Intronic
1097077082 12:56403034-56403056 ACTTGGAAGAGGTATGTGGATGG + Intergenic
1097554689 12:61122243-61122265 TTGGGATACAGGTATGTGGATGG + Intergenic
1097564562 12:61251811-61251833 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1097719143 12:63001636-63001658 CAGGGTAAGAGGTCTGGGGATGG - Intergenic
1097774233 12:63627753-63627775 CTAGGGAAGTGGTGTATGGAGGG - Intronic
1097821263 12:64131276-64131298 TTGTGGAAGAGGTATGTGGATGG - Intronic
1097843265 12:64342120-64342142 TTGGGGAAGAGGTATGTGGATGG - Intronic
1098716185 12:73830441-73830463 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
1098733375 12:74066263-74066285 TTGAGGAAAAGGTATGTGGATGG + Intergenic
1098749929 12:74280228-74280250 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098832201 12:75376322-75376344 CTGGAGAACAGGTATGGGAATGG - Intronic
1099183297 12:79491971-79491993 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1099366019 12:81766016-81766038 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1099401116 12:82204726-82204748 TGGGGGAAGAGGTATGTAAATGG - Intergenic
1099490589 12:83283619-83283641 TTCGGGAAGAGGGATGTAGATGG - Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1099689864 12:85938653-85938675 TTAGGGAAGAAGTATGTGGATGG + Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1100471080 12:94893695-94893717 CTAGGGTAGAGGTATGTGGAAGG - Intergenic
1101466983 12:104958555-104958577 GTGGGGAAGAGGGATGCCGAAGG - Intronic
1101484054 12:105133123-105133145 ATGGGGAAGGGATTTGTGGAAGG - Intronic
1101534578 12:105605474-105605496 TTGGGGAAAAGGTATGTGGGTGG - Intergenic
1101730385 12:107422167-107422189 CTGGGGGAGAGGAATCTAGATGG + Intronic
1102655585 12:114480101-114480123 CTGGGGAAGAGGGAAGTAGTGGG + Intergenic
1102826265 12:115950169-115950191 CTGGGTAAGAGGTGAGGGGAAGG + Intergenic
1102894822 12:116590409-116590431 CTGGGGGAGAGGTATGGGACAGG - Intergenic
1103035709 12:117654704-117654726 TTGGGGAAGAGGTATGTGGATGG + Intronic
1103225668 12:119285227-119285249 TTGGGGAAGGGGTTTGTGGTTGG - Intergenic
1103396623 12:120612080-120612102 TTGGGGAAGAAGTATGTAGATGG + Intergenic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1104209963 12:126679224-126679246 CTGGGAAAGAGGCACATGGATGG - Intergenic
1104859266 12:131916197-131916219 CTGGGGAAGATGTGTGGGAATGG + Intronic
1105728359 13:23187301-23187323 CTGAGGAAGAGGCTTGTGGATGG - Intronic
1105740207 13:23315813-23315835 TTGGGGAAGAGATATGTGGATGG + Intronic
1106767866 13:32933372-32933394 CTGAGGAAGAGGTGTGGGGAAGG + Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107955412 13:45506570-45506592 CTGGGGTAGGGGTGTGAGGATGG + Intronic
1107983490 13:45755330-45755352 TTGGTAAAGAGGTATGTGGATGG - Intergenic
1108286540 13:48914778-48914800 CTGGGGAAGAAATGTGTGGAAGG + Intergenic
1108368517 13:49743040-49743062 CTGGGGTGGAGGGATGTAGATGG + Intronic
1108914219 13:55588253-55588275 TTGGGGAAAAGATAAGTGGATGG - Intergenic
1108944923 13:56010240-56010262 CTGGGGAAGAGTTATGTGTATGG - Intergenic
1109293310 13:60500747-60500769 TTGGGAAAGAGGTATGTTGATGG + Intronic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1109519114 13:63485433-63485455 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1110377253 13:74807102-74807124 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1110834051 13:80063997-80064019 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111198623 13:84905514-84905536 TTGGGGAAGAGGTATTTGGATGG + Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111450422 13:88407976-88407998 CTGGGGAATAGTCATGTGGGTGG + Intergenic
1111535285 13:89595805-89595827 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1112249841 13:97769647-97769669 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1112915181 13:104539487-104539509 GTGGAGGAGAGGTATGTGGAAGG + Intergenic
1113319613 13:109221040-109221062 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1113396225 13:109950165-109950187 TTGGGGAAGAGGTATGTAGATGG + Intergenic
1113566662 13:111323341-111323363 CTGGGGAAGAGGCGTGTGTGGGG + Intronic
1113884628 13:113652134-113652156 CCAGGGAAGAGGTGTGGGGAAGG - Intronic
1114205951 14:20571402-20571424 TTGGGGAAGATGTATGTGGATGG + Intergenic
1114407632 14:22471630-22471652 ATGTGGAAGAGGGATGTTGAGGG + Intergenic
1114493713 14:23118800-23118822 CTGGGCCGAAGGTATGTGGAGGG + Exonic
1114758166 14:25283247-25283269 TTGGGGAATAGGTATGTGGATGG - Intergenic
1114765136 14:25362026-25362048 CTTGGGAAGAGTCAAGTGGATGG + Intergenic
1115059798 14:29174523-29174545 TTTGGGAAGACATATGTGGATGG + Intergenic
1115130780 14:30049892-30049914 TTGGGGAAGAGCTATGTGGATGG + Intronic
1115278049 14:31630543-31630565 CTTTGAAAGAGGTATATGGAGGG - Intronic
1115328273 14:32166411-32166433 CTGGGGCAGAGACATGTGGATGG + Intergenic
1116058989 14:39897558-39897580 TTGGGTAAGAGGTATGTGGATGG + Intergenic
1116068179 14:40009800-40009822 TTGGGGAAGAGGTATGTCGATGG + Intergenic
1116249136 14:42458266-42458288 TTGGGGAAGAGATATGTGGAAGG + Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116983437 14:51194953-51194975 CTGGGAAGGAGGTATGTGAATGG + Intergenic
1117045399 14:51808424-51808446 CAGAGGCAGAGGTATGTAGAGGG + Intergenic
1117216935 14:53560806-53560828 TTGGGGAAGGGTTATGTGGATGG + Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117355321 14:54918551-54918573 CAGGGGAAGAGGGATTTAGAGGG + Intergenic
1117596187 14:57329252-57329274 TTGGGGAAGAGTTATGTGGATGG - Intergenic
1117634218 14:57725006-57725028 CTGGGGAAGAGATAAGTGGATGG + Intronic
1118073460 14:62271431-62271453 CTGGGGAAGAGGTTTGTGGGAGG - Intergenic
1118122348 14:62859537-62859559 TTGGGGAAGAGGTATGTGGATGG - Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118880689 14:69823388-69823410 TTGGGAAAGAGGTATGTGGACGG - Intergenic
1119107474 14:71938209-71938231 TTGGGAAAAAGTTATGTGGATGG - Intronic
1119642240 14:76324081-76324103 CTGGGCAAGAGCTGTGTTGAGGG + Intronic
1120081936 14:80226897-80226919 GTGGGGAAGACGTATGTGGATGG - Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120555906 14:85929805-85929827 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1120702277 14:87711333-87711355 CTGGGGAAGAGATATCTGAATGG - Intergenic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120946104 14:89998703-89998725 TAGGGGAAGAGCCATGTGGATGG + Intronic
1122058837 14:99123282-99123304 CAGGGGAAGAGGGAAGGGGAAGG - Intergenic
1122347097 14:101067441-101067463 CTGGGGAAGAGGGGTGCTGAGGG - Intergenic
1122729943 14:103789007-103789029 TTGGGGAAGATGTTTCTGGAGGG - Intronic
1125520164 15:40343991-40344013 CTGGGGAGGAGATGTGTAGATGG + Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126199895 15:45973871-45973893 CTGGGGAAGATGCATGTAGGAGG + Intergenic
1126283692 15:46986910-46986932 TTGGGGAAGAGATATGTGGATGG + Intergenic
1126966802 15:54063314-54063336 CTGAGTAAGAGGTGTGTGGTGGG + Intronic
1127251233 15:57240579-57240601 GTGGTAAAGAGGTATGTTGAGGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128482607 15:68053346-68053368 TTGGGGAGGAGGTATATAGAAGG + Intergenic
1128587898 15:68867134-68867156 CTGGGTAAGAGTTACGAGGATGG - Intronic
1128642893 15:69352857-69352879 TTGGGGAAGAGGTATGTGGATGG + Intronic
1128689510 15:69712709-69712731 CTGGGGAACAGGTACTCGGAGGG + Intergenic
1128990680 15:72257336-72257358 CTGGAGCAGAGGTATGGGGGAGG - Exonic
1129865612 15:78906086-78906108 CTGAGGAGGAGTTATGTAGATGG + Intergenic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1129904272 15:79175090-79175112 CTGGGCAGGAGGTATGTGTTGGG + Intergenic
1129906775 15:79193315-79193337 CAGGGGAAGAGACATCTGGAAGG + Intergenic
1130365510 15:83234638-83234660 CTAGGGAAGAGATATGGGGATGG + Intergenic
1130525627 15:84703772-84703794 CTGAGGAAGAGATATGTGGATGG + Intronic
1130573916 15:85073846-85073868 CTGGGGAAGAGCTATGGGAAAGG - Intronic
1130766614 15:86877534-86877556 CTGGGGAAGGGATAAGTAGAAGG + Intronic
1130938478 15:88489379-88489401 CTGGGGCAGAGGTCTCTGCATGG - Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131724101 15:95203431-95203453 TTAGGGAACAGGTATGTGGACGG + Intergenic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132351729 15:101143501-101143523 CTGGGGAGCAAGTGTGTGGATGG + Intergenic
1132851165 16:2025656-2025678 CTGGGAACCAGGTATGTGCAAGG + Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133695847 16:8261722-8261744 CTGGGGTAGAGTTAAGTGAAGGG - Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135924341 16:26679412-26679434 CTGGGGATGGGGTATGTCCAAGG - Intergenic
1136598330 16:31266804-31266826 TTGGGGAACAGGGGTGTGGAAGG - Intronic
1137270424 16:46899425-46899447 CTGGGGCAGAGGGCTGGGGAGGG + Intronic
1137384727 16:48030733-48030755 GTGGGGAAGGTGTATGTGGGTGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137723246 16:50640070-50640092 CTGGGGAAGAGCTCTCTGAAGGG - Exonic
1138868466 16:60851415-60851437 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1139427795 16:66894028-66894050 CTGGGAGAGTGGTCTGTGGAGGG + Intronic
1140246206 16:73252343-73252365 CTGGGGTAGTGGCATGGGGACGG + Intergenic
1140327360 16:74017829-74017851 CTGGGGTAGAGATATGGGGAAGG - Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140476607 16:75242281-75242303 CCGGGGAAGATGGATGTGAATGG - Intronic
1141172583 16:81700688-81700710 CTGGGGAAGAGGCAGCGGGAAGG + Intronic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141847494 16:86620940-86620962 GTGGGGAAGAGGTGTTTCGAGGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1143432714 17:6898796-6898818 CCAGGGAATAGGTACGTGGAGGG + Intronic
1143488801 17:7271518-7271540 CTAGGGTAGAGGTCTGAGGATGG + Intergenic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1143994808 17:10997229-10997251 CTGGGGCAGAGGGCTGGGGAAGG - Intergenic
1144404035 17:14935102-14935124 CTGAGGAAGAGTTATGCAGATGG - Intergenic
1144720160 17:17463542-17463564 CTGGGGAAGAGGCATGGAGCTGG - Intergenic
1144730504 17:17523290-17523312 CTGGGGTGGAGGTAGGTGGCTGG - Intronic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1146851021 17:36221671-36221693 TTGGGGAAGAAGTATGTACATGG + Intronic
1146911584 17:36651744-36651766 CTGGGGGAGAGGTAGGTAGGGGG - Intergenic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147904234 17:43812721-43812743 CTGGAGAAGAGGTACCTGGATGG - Intronic
1148062737 17:44847900-44847922 CTGGGGAAGAGGCAGATGGTAGG + Exonic
1148068867 17:44894626-44894648 CTGGAGAGGAGGCATGTGAAAGG - Intronic
1148122943 17:45222955-45222977 CTGGGGAATAGGTCTCTGGGAGG + Intronic
1148471366 17:47895874-47895896 CTGGGTTAGAGGTGGGTGGAAGG + Intergenic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1149291812 17:55225061-55225083 CTGGGAAGGTGGTATGTGGATGG - Intergenic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1151037716 17:70820967-70820989 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1151510852 17:74558980-74559002 CTGGGAGAGAGTTATTTGGATGG - Intergenic
1151585460 17:75005631-75005653 CTGGGGGAGAGGAGTGTGGAAGG + Exonic
1152164883 17:78696898-78696920 CTTGGCAATAGGAATGTGGAAGG + Intronic
1152830875 17:82496409-82496431 TTGCTGATGAGGTATGTGGATGG + Intergenic
1153089802 18:1330790-1330812 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1153131184 18:1857070-1857092 ATGGGGAACGGGTATGTGGATGG - Intergenic
1153137576 18:1934239-1934261 CTGGGGGAGAGGCATGTAGCTGG - Intergenic
1153217603 18:2834974-2834996 TCGGGGAAGAGGTATGTGGATGG - Intergenic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1153746590 18:8185907-8185929 CTGGGGAACAGGACTGTGTATGG - Intronic
1154068551 18:11131727-11131749 TTGGGGAAGAGGTTTGTGGATGG + Intronic
1155492255 18:26410671-26410693 CTGGGGAGGTGGTAGGGGGAGGG + Intergenic
1155706697 18:28824276-28824298 GTGGGGAAAAGGTAAGTGGGAGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156116884 18:33796252-33796274 CCGGGGAAGAAGTATTTGAATGG - Intergenic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156303941 18:35859323-35859345 TTTAGGAAGAGGTACGTGGATGG + Intergenic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156868237 18:41913002-41913024 CTAGAGAAGAGGTATGATGATGG - Intergenic
1156998664 18:43498358-43498380 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157341295 18:46780653-46780675 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157870846 18:51228968-51228990 GTGGGGAAGAGGTATGTTAATGG - Intergenic
1157998414 18:52587496-52587518 TTGGGGAAGAGGTTTGTGGATGG - Intronic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1159225808 18:65534279-65534301 ATGAGTATGAGGTATGTGGATGG + Intergenic
1159559016 18:69974735-69974757 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1162291489 19:9784259-9784281 CTGGGCAAGGGGGATGTGGCAGG + Intronic
1163035770 19:14567974-14567996 CTGGGGAGGAGGGATGTGGGAGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164117171 19:22233943-22233965 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1164836522 19:31358400-31358422 CTGGGGAAGAGGTACTGAGAGGG - Intergenic
1165462691 19:35953354-35953376 CTGGGGAAGAGGGATGGCGTGGG - Intergenic
1165661567 19:37585198-37585220 CTGGGCAAGAGGGTTGTAGAAGG + Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166347012 19:42172818-42172840 CTGGGAGACAGGTCTGTGGATGG + Intronic
1166557317 19:43709271-43709293 TTGGGGAAGGGGTTTGGGGAAGG - Intergenic
1167663075 19:50807836-50807858 CTGGGGTAGAGGGATAGGGAAGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168538380 19:57191073-57191095 CCGGGGAGGAGGGATGTGAAAGG + Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925263884 2:2551031-2551053 CTGGGGAAGAAGTTTGCAGAGGG - Intergenic
925280044 2:2677493-2677515 TTTGGGAAGAGGTATGTAGATGG + Intergenic
925460808 2:4061075-4061097 TTGGGGAAGAGGTATGTGGATGG + Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925499327 2:4486302-4486324 GTGGGGGAGAGGTATGTGGATGG - Intergenic
925772653 2:7298386-7298408 CTGGGGAAGACGTATGTGGATGG - Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
926384196 2:12319841-12319863 CTGGAGATGAAGTAGGTGGAGGG + Intergenic
926826854 2:16914297-16914319 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927008798 2:18880353-18880375 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927267256 2:21163799-21163821 CTGGAGAAGAGGCATTTGAATGG - Intergenic
927660514 2:24989267-24989289 TTGGGGAAGAGGTATGTAGGTGG + Intergenic
929007916 2:37413583-37413605 CCTGGGAAGAGGTCTGGGGATGG + Intergenic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929665664 2:43831999-43832021 CTGGGGGAGGTGTATGTGAACGG - Exonic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930295130 2:49544753-49544775 TTGGGCAATAGGTATGTGGATGG - Intergenic
930327073 2:49933427-49933449 CAGGTGAAGAGGAATGTGGCTGG - Intronic
930536525 2:52651635-52651657 CTGGGGAAGAGGTATGTAGATGG - Intergenic
931224917 2:60321367-60321389 CTGGGGAAGTGCTGGGTGGAAGG - Intergenic
931282694 2:60808010-60808032 TTGGGGAAAAGGTATGAGGCTGG + Intergenic
932326615 2:70866617-70866639 CTGGGTAATAGGTATATGGTGGG + Intergenic
933265602 2:80177747-80177769 TTGGGGAAGAGGTATATAGATGG - Intronic
933394386 2:81712725-81712747 TTGGGGAAGAGGTATGTGGATGG - Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933906792 2:86902048-86902070 CTGGGGAAAGGTGATGTGGAAGG + Intergenic
934024684 2:87991586-87991608 CTGGGGAAAGGTGATGTGGAAGG - Intergenic
934050577 2:88207189-88207211 TTGGAGAAAAGGTTTGTGGATGG + Intergenic
934534715 2:95123275-95123297 CTAGGAAACAGGTATGTGGATGG - Intronic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935184030 2:100715526-100715548 CTAGGGAAGAAGTATGTGGATGG + Intergenic
935425021 2:102910698-102910720 TTAAGGGAGAGGTATGTGGATGG - Intergenic
935438838 2:103067904-103067926 AGGGGCAAGAGGTATGTGGATGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
936430470 2:112458209-112458231 CTGGGGAAGAGGTATATTGTTGG + Intergenic
936467470 2:112766036-112766058 CTGGAGAAGTCGTGTGTGGAGGG + Intergenic
936641313 2:114315318-114315340 TTGGGGAAGAGGTATATGGATGG + Intergenic
936933267 2:117812270-117812292 CTTGGGAAGGGGTCTGGGGATGG - Intergenic
937219436 2:120333308-120333330 CTGCTGAAGAGGTAGTTGGATGG - Intergenic
937501914 2:122488391-122488413 ATGGGGAAGAGGTTTGTTGTTGG - Intergenic
937581976 2:123498519-123498541 TTGCAGAAAAGGTATGTGGATGG - Intergenic
937785115 2:125887097-125887119 TTGGGGAAGAGGTATGTGGATGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
937852481 2:126648107-126648129 TTGGGGAAGAGGTATGTGGATGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
939069167 2:137518515-137518537 TTGGCGATGAGGTATGTGGATGG + Intronic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
939213953 2:139212868-139212890 TTGGGGAAGAGTTACGTGGATGG + Intergenic
939788593 2:146545480-146545502 TTGGGGAAAAGGTATGTGGATGG - Intergenic
939857853 2:147382047-147382069 TTGGGGAGGCTGTATGTGGAGGG + Intergenic
940089344 2:149898477-149898499 CTGGGAAACAGTCATGTGGATGG - Intergenic
940171227 2:150832081-150832103 CTGGGGAATAGTTATGTGGCTGG - Intergenic
940357911 2:152765811-152765833 GTGGGGAAGAGATATATAGATGG - Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
941668107 2:168261759-168261781 TTGGGGAAAAGTTATGTGGATGG + Intergenic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943317840 2:186411689-186411711 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
943361032 2:186919608-186919630 CTTGGAAAGGAGTATGTGGATGG - Intergenic
943383983 2:187180462-187180484 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943392202 2:187284095-187284117 CTGGAGAACAGGCATGGGGATGG - Intergenic
943517510 2:188906627-188906649 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943833528 2:192490516-192490538 TTGGGGAAGAGGTATGTGGATGG - Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944498190 2:200329696-200329718 GTGGGGAAGGGGGATGTGGGTGG - Intronic
945011483 2:205468631-205468653 CTGAGGAAGAGGTAGGGGAATGG + Intronic
945026632 2:205625660-205625682 CTCGGGAGGAGGGGTGTGGAAGG - Intergenic
945146427 2:206743043-206743065 CTGGAGAACAGGTATGGGAATGG + Intronic
945293462 2:208147597-208147619 CTGGGGTAGAGGAATGTGCAGGG - Intergenic
945544950 2:211138774-211138796 TTGGGAAAGAGGTATGTGGATGG + Intergenic
945642264 2:212444466-212444488 CTGGGGAAGAGGTATGTGGGTGG + Intronic
945725765 2:213470872-213470894 TTGGGGCAGAGATATGTGGATGG - Intronic
946024601 2:216664346-216664368 CTGGGGTACAGGTTTGGGGAGGG + Exonic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946527782 2:220539341-220539363 CTGAGGAAGAGATACGTGGGTGG - Intergenic
946703676 2:222437165-222437187 TTGGGGAAGAGGTATGTGGATGG - Intronic
947440930 2:230120879-230120901 TTAGGGAAGAGGTATGTGGATGG + Intergenic
947506922 2:230714048-230714070 TTGCAGAAGAGGTGTGTGGAAGG + Intronic
948028457 2:234797538-234797560 CAGGGAGAGAGGTGTGTGGATGG + Intergenic
948258945 2:236588954-236588976 CCGGGGATGAGGTATGGGGATGG + Intergenic
948706312 2:239795602-239795624 TAGGGGAAGAGGGATGGGGAGGG - Intronic
948847509 2:240690236-240690258 CCTGGGAAGAGGTCAGTGGATGG + Intergenic
948910989 2:241002547-241002569 CTGGGGAAGTGGAATGGGGCTGG + Intronic
1168846038 20:945254-945276 CTGGGCAGGAGGTTTGTGGGTGG + Intergenic
1169372809 20:5041681-5041703 CTGGGGCAGAGTTCTCTGGAAGG - Intergenic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169660429 20:7972910-7972932 CTGGGGAGGAGGTGGGTGGGAGG - Intergenic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1170134182 20:13055010-13055032 CTAGGAAAGAGGCAGGTGGAAGG + Intronic
1170160459 20:13304861-13304883 GTGGGGAAGAGAGATGGGGAAGG - Intergenic
1170786126 20:19469185-19469207 CTGGGGATGAAGGATGTGCATGG + Intronic
1170935950 20:20809685-20809707 CTGGGAAACAGGCATTTGGATGG - Intergenic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171118443 20:22547525-22547547 GTGGGGAAGAGGGCAGTGGAAGG + Intergenic
1171452411 20:25245518-25245540 CTGGGGGAGGGGTCAGTGGATGG + Intergenic
1171945547 20:31373939-31373961 CTGTTGTAGAGTTATGTGGATGG - Intergenic
1172105802 20:32516742-32516764 CTGGCAAGGAGGGATGTGGAGGG + Intronic
1173745013 20:45429491-45429513 CTGGGCAAGAGGTATGAGCCGGG + Intergenic
1173800824 20:45893301-45893323 CTGGGGAACAGGTATGGGATAGG + Exonic
1174459782 20:50674114-50674136 CTGGGTAAGATGTGTCTGGAAGG + Intronic
1174594671 20:51674446-51674468 CTGGGGTAGAGGTGTTTGTAGGG - Intronic
1175523356 20:59617219-59617241 CATGGGAATAGGTATGAGGAGGG - Intronic
1175874547 20:62223158-62223180 CTGGGCCAGAGCCATGTGGACGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176998245 21:15580809-15580831 TTGGGGAAGAGATATGTGGATGG + Intergenic
1176998257 21:15580897-15580919 TTGGGGAAGAGATATGTGGATGG + Intergenic
1177139327 21:17341634-17341656 TTGGGGAAGATGTATGTGGATGG - Intergenic
1177569507 21:22869976-22869998 TGGGGGAAGAGGTACGTAGATGG - Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1177913262 21:27056839-27056861 TTGGGAAAGAGGTATGTGGATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178050805 21:28745315-28745337 CTGGGGAGTAAGTATGTGAAAGG - Intergenic
1178230878 21:30783094-30783116 AGAGGGAAGAGGTATATGGAAGG - Intergenic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179508793 21:41858748-41858770 CTGGGGAAGAGGGGGGTTGATGG + Intronic
1179551530 21:42146705-42146727 CTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179628376 21:42661382-42661404 CTGGGGGAGGGGGATGGGGAGGG - Intronic
1180004284 21:45012906-45012928 CTGGGGAAGAGGTGTCTGGATGG + Intergenic
1181065243 22:20302723-20302745 CTGGGGCAGATGTAAGGGGAAGG + Intergenic
1181172349 22:21016796-21016818 CTGGGGATGAGCTGGGTGGAGGG - Intronic
1181367307 22:22387902-22387924 TTGGGGAAAAGATATGTGGATGG - Intergenic
1181420802 22:22797039-22797061 TTGGGGAAGAGCTATGTGGATGG - Intronic
1181794906 22:25300431-25300453 TTGGAGAAGAGATATATGGAGGG + Intergenic
1182341990 22:29630574-29630596 TTGAGGAGGAGGTCTGTGGAAGG + Intronic
1182965669 22:34519099-34519121 CTGGAGAACAGGTATGGGAATGG - Intergenic
1183463597 22:37967958-37967980 CTGGGGAACAGGGAGATGGAGGG - Exonic
1183715500 22:39530956-39530978 CGGGGGGAGGGGCATGTGGAAGG + Intronic
1183986904 22:41575093-41575115 CTGGCCAGGAGGTAGGTGGAGGG + Exonic
1185000514 22:48242680-48242702 GTGGGGATGGGGCATGTGGAGGG - Intergenic
1185127337 22:49018441-49018463 CAGGGGAGGAGGTCTGTGGAAGG + Intergenic
949125577 3:442483-442505 TTGGGGAAGAGTTATGTGGATGG - Intergenic
949169950 3:985970-985992 TTGGGGACGAGGTATGTGGATGG - Intergenic
949245961 3:1925554-1925576 TTGGGGAAGAGGTATGTGGATGG + Intergenic
949465457 3:4339061-4339083 CTGAGGAAGTAGTTTGTGGAAGG - Intronic
949576171 3:5340971-5340993 TCGGGGAGGAGCTATGTGGAAGG - Intergenic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
950118242 3:10464942-10464964 CTGGGGTAGAGGTGGGTGGCAGG - Intronic
950714410 3:14837467-14837489 CTGGGGGGGATGTATTTGGATGG + Intronic
950891748 3:16410369-16410391 ATGGGGAAGGCTTATGTGGATGG + Intronic
951291434 3:20876114-20876136 TTGGGGAAGAGGTATGTGGATGG - Intergenic
951384609 3:22028148-22028170 TTGGGGAAGAGGTATGTGGATGG + Intronic
951970677 3:28441259-28441281 TTGGGGAAGAGGTATGTGGATGG - Intronic
952553005 3:34500362-34500384 CAGTGGAGGAGGTATGTGCAGGG + Intergenic
952836119 3:37603743-37603765 CAAGGGAAGAGATATGTGAAAGG - Intronic
953233522 3:41085612-41085634 CAGGGGCATAGGCATGTGGATGG - Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953695046 3:45151417-45151439 CTTGAGAAGAGGTATGTAGGAGG - Intergenic
953697829 3:45173449-45173471 CTGGGAAAGAGGCACCTGGATGG - Intergenic
953931579 3:47008431-47008453 CTGGGGCCCAGGTATGGGGAAGG + Exonic
954054247 3:48008587-48008609 TTGGGGAAGAGGTATGTGGATGG + Intronic
954411762 3:50374114-50374136 TTGGGGAGGAGGTAAGGGGAAGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954539661 3:51385187-51385209 ATGGGGAAGTGGCATGTGGGAGG + Exonic
954856645 3:53649517-53649539 GTGGGGGGGAGGTGTGTGGAGGG - Intronic
954873838 3:53787689-53787711 ATGGGAAGCAGGTATGTGGAGGG + Intronic
954901837 3:54026596-54026618 TAGGGGAAGAAGTACGTGGAGGG - Intergenic
956151793 3:66251301-66251323 CTGGGGCAGAGGGATGCAGAGGG + Intronic
956509749 3:69981002-69981024 TTGGGGAGGAGGTATGTGGATGG + Intergenic
956920754 3:73926730-73926752 TTGGGGTAGAGGGATGAGGAAGG - Intergenic
956985376 3:74693218-74693240 CTAGGGAGAAGGTAGGTGGAAGG + Intergenic
957247482 3:77733266-77733288 TTGGGGAAGAGGTATGTGGATGG - Intergenic
957285918 3:78217637-78217659 CTGGTGAAGAAGTTTATGGAAGG - Intergenic
957385810 3:79495588-79495610 AGGGGGAAGTGTTATGTGGAAGG + Intronic
957491842 3:80937479-80937501 CTAGGGAAGAGGATTGTGAATGG - Intergenic
957514498 3:81233030-81233052 CTGAGTAAGAGGCATGTTGATGG - Intergenic
957754673 3:84470056-84470078 TTGGACAAGATGTATGTGGATGG + Intergenic
958258924 3:91356103-91356125 TTGGGGAAGAGGTATGTTGATGG - Intergenic
958487591 3:94731845-94731867 TTGGGGAAGAGGTATGAGAATGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
958934393 3:100241242-100241264 TTGGGGAAGAGATATGTGGATGG + Intergenic
959203567 3:103278618-103278640 TTAGGGTAGAGGTATGTGGAGGG - Intergenic
959237768 3:103746503-103746525 TTGGAGAAGAGGTATGTAGATGG - Intergenic
959745930 3:109776643-109776665 TTGAGGAAGAAGTATGTGGATGG - Intergenic
959997950 3:112698950-112698972 TTGGGGAAGAAGTATGTGAATGG + Intergenic
960349610 3:116576331-116576353 TTGGGGAAGAAGTATGTGGATGG + Intronic
960494657 3:118360124-118360146 TTGGGGAAGAGGTAAGTGGGTGG - Intergenic
960528424 3:118736635-118736657 CAGAGAAAGAGGTATGTAGATGG - Intergenic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
961472253 3:127122915-127122937 CTGGGGAGGAGATATGTGGGCGG + Intergenic
961710888 3:128827402-128827424 TGGGGAAAGAGGTATGTGGATGG - Intergenic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963331726 3:143922744-143922766 TTGGGGAACAGGTATGTGGATGG - Intergenic
963582714 3:147147170-147147192 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
963630393 3:147723852-147723874 TTGCGGAAGAGTTATGTGGATGG + Intergenic
963699118 3:148601668-148601690 CTAGGGAACAGGTATATAGATGG - Intergenic
963970229 3:151421325-151421347 TTGGGGAAGAGGTATGTGGCTGG - Intronic
964029506 3:152120208-152120230 CCCGGGAAGAGGAATATGGACGG + Intergenic
964505614 3:157395663-157395685 TTTGGGAAGAGATATGTGGATGG - Intronic
964679148 3:159318285-159318307 TTGGGGAAGAGGTATGTGGATGG - Intronic
964924121 3:161935445-161935467 CTGTGGAAGAGATATTTGGGGGG + Intergenic
965226677 3:166000143-166000165 TTGGGGAAGAAGTATGTGGCTGG - Intergenic
965291662 3:166888962-166888984 TTGGGTAAGAGGTATGTGGATGG - Intergenic
966445776 3:179999189-179999211 TTGGGGAAAAGGTATGTGGATGG + Intronic
966896928 3:184452186-184452208 CTGGGGAACATGTATGGGAATGG - Intronic
967505578 3:190249473-190249495 CTGGGGAACAGGCATGGGAATGG - Intergenic
967831871 3:193926620-193926642 TTGGGGAAAAGACATGTGGATGG + Intergenic
967977484 3:195043698-195043720 GGGGGGAAGAGGGATGGGGATGG - Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968234690 3:197024564-197024586 CTGTGGGAGAGGTGTGTGCACGG + Intronic
968800275 4:2738762-2738784 TTGAGGAAGAGGTATGTGGATGG + Intergenic
968907094 4:3459042-3459064 TTGGGGAAGAGGTATGTGGATGG + Intergenic
969343402 4:6556613-6556635 CTGGGGAAGAGGTGTGTGGATGG - Intronic
971100928 4:23465792-23465814 CTGGGGAAGAGGTATGTGAATGG - Intergenic
971453664 4:26823360-26823382 CTGAGGAATAGGTACATGGATGG - Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971687302 4:29786458-29786480 TTGGGGAAGACGTATGTGGATGG - Intergenic
971817312 4:31505702-31505724 TTGGGGAAGAGGTATGTGAATGG + Intergenic
971857564 4:32062224-32062246 TTGGGAAAGAGGTATATAGATGG - Intergenic
971858369 4:32072193-32072215 CTGGAGAACAGGTAAGTGAAGGG - Intergenic
971979216 4:33732244-33732266 TTGAGGAAGAGGTATGTAGATGG - Intergenic
972085306 4:35207726-35207748 TTAGGGAAGAAGTATGTGGATGG + Intergenic
972109552 4:35541135-35541157 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
972201219 4:36716554-36716576 TTAGGGAAGAGGTATGTAGATGG - Intergenic
972291856 4:37697144-37697166 CTGGGGAAGAGGTATGACCTTGG - Intergenic
972464066 4:39335781-39335803 GTGGGGAAGATGTATGTGAATGG - Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
972828666 4:42788957-42788979 ATGGGGAAGAGGCATATGGATGG + Intergenic
972882882 4:43447548-43447570 TTGAGGAAGAAGTATGTGGATGG - Intergenic
973102999 4:46295371-46295393 TTGAGGAAGAAGTATGTGGATGG + Intronic
973118525 4:46489673-46489695 TTGGGGAAAAGGTATGTGGTTGG + Intergenic
973120911 4:46520275-46520297 TTGGGGAAGAGGTACGTGGATGG - Intergenic
973130101 4:46639068-46639090 TTGGGGAAGAGGTATGTGGATGG - Intergenic
973992075 4:56419089-56419111 CTGGGGATGAGGGATGAGGCAGG + Intronic
974289650 4:59913372-59913394 TTGGGGAAGAGGTATGTGGATGG + Intergenic
974373852 4:61051042-61051064 CTGAAGAAAAGGCATGTGGATGG - Intergenic
974564876 4:63568939-63568961 TTGGGAAAGAGGTATGTGGATGG + Intergenic
974746825 4:66088275-66088297 TTGGGGAAGAGGTATGTGGATGG - Intergenic
974932826 4:68378797-68378819 CTGGGGCAGAGGCATGGGGCAGG + Intergenic
975106197 4:70571655-70571677 CTGGTGAAGAGATATGGGAACGG + Intergenic
975131025 4:70833117-70833139 ATGGGCCAGCGGTATGTGGAAGG - Exonic
975386631 4:73766883-73766905 TTGGGGAAGAGATATGTGTGTGG - Intergenic
975493733 4:75015409-75015431 CTGGGGAAGAGAGGTGTGGCCGG + Intronic
975716060 4:77206712-77206734 TTTGGGTAGAGGAATGTGGATGG - Intronic
975733997 4:77364313-77364335 CTGGAGAACAGGCATGGGGATGG - Intronic
975982519 4:80176650-80176672 TTGGGGAAGAGGTACATGGAAGG - Intergenic
976034124 4:80795192-80795214 TTGGAGAATAGGTATGTGGATGG - Intronic
977031734 4:91892438-91892460 TTGGGAAAGAGGTATGTGGACGG + Intergenic
977204355 4:94153006-94153028 CTGGAGAATAGGTATGAGAATGG + Intergenic
977466091 4:97384004-97384026 TTGGGGAAGAGGTTTGTGGTTGG + Intronic
977489996 4:97699445-97699467 TTATGGAAGAGGTATGTGGATGG - Intronic
977565827 4:98579312-98579334 CTTGGGCATAGGTTTGTGGAGGG - Intronic
977833143 4:101617208-101617230 TTGGGGAAGAGGTATGTGGATGG - Intronic
977930320 4:102743190-102743212 TTGGGGAAGAGGTACGTGGGTGG - Intronic
978341495 4:107724919-107724941 TTGGGGAAGAGGTATGTGGATGG - Intergenic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978772071 4:112467158-112467180 TTGGGGAAGAGGTACATGGATGG - Intergenic
978898982 4:113926183-113926205 TTGGGGAATAGGTATGTGGATGG - Intronic
978921252 4:114185097-114185119 GTGGGGCGGAGGTATGTGGGAGG + Intergenic
978925144 4:114233656-114233678 GTGGGGCGGAGGTATGTGGGAGG + Intergenic
978966939 4:114751552-114751574 TTGGGGAAGAGGTATGCAGATGG + Intergenic
978974915 4:114857850-114857872 CTAAGAAAGAGGCATGTGGATGG + Intronic
979011426 4:115375418-115375440 CTGGAGAACAGGTCTTTGGAAGG + Intergenic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
979840918 4:125439166-125439188 CTCTGGAATAGATATGTGGAAGG - Intronic
979898329 4:126188438-126188460 TTGGGGAAGAGGTATGTGGATGG - Intergenic
980385700 4:132086407-132086429 TTGAGGAAGAGGTATGTGGATGG - Intergenic
980387860 4:132110551-132110573 TTGGGGAAGAGCTATGTGCATGG - Intergenic
980405806 4:132353160-132353182 TTGGGGAAGAGGTATGTGCATGG - Intergenic
980629605 4:135414921-135414943 TTGGGGAAGAGTTATGAGGATGG + Intergenic
981048647 4:140289984-140290006 CTGGGGTAGAGGCATGTCAATGG - Intronic
981308102 4:143267934-143267956 ATGGGGAAGAGAAATGTGGTTGG + Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
981462900 4:145032423-145032445 TTAGGGAAGAGGTATGTGGATGG + Intronic
981835089 4:149044569-149044591 TTGAGGAAGGGGTATGTGGATGG + Intergenic
981873624 4:149515829-149515851 TTGGGGAAAAGGTATGTGGATGG + Intergenic
982205075 4:152991586-152991608 CAGGGAAAGAGGGATGTGGGGGG + Intergenic
982300995 4:153879406-153879428 CTGGGGAAGAGATATGTGGATGG + Intergenic
982360306 4:154512315-154512337 CTGGGGATGAGGTATGGGATGGG - Intergenic
982597686 4:157406415-157406437 TTGGGGAAGAGGTATGTGGATGG - Intergenic
982623251 4:157732254-157732276 GTGGGGAAGAGGTGTGTGGATGG - Intergenic
983185152 4:164692203-164692225 TTGGGGAAGAGGTATGTGGAAGG + Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
983365382 4:166780490-166780512 GTAGGGAAGATGGATGTGGATGG - Intronic
983582766 4:169325442-169325464 TTGGGGAAGAAGTATGTGGATGG + Intergenic
984060199 4:174981396-174981418 TTTGGGAAGAGGTATGTGGATGG - Intergenic
984418176 4:179487038-179487060 TTGGGGGAGAGACATGTGGATGG - Intergenic
985671898 5:1211003-1211025 CTGGGCAAGAGGGTTCTGGAAGG - Intronic
986025663 5:3848044-3848066 TTGACGAAGAGGTATGTGGATGG + Intergenic
986087193 5:4463347-4463369 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
986187670 5:5459944-5459966 TTGGGGAGGAGATATGTGGTGGG + Intronic
986261542 5:6151893-6151915 TTGGGGAAGAGGTATGTGGATGG - Intergenic
986531315 5:8739697-8739719 TTGGAGAAGAGGTATGTGAATGG - Intergenic
986743038 5:10720389-10720411 TTGGGGAAGAGGTATGTGGATGG + Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987468059 5:18296015-18296037 TTGGGGAAGAGGTATGTGGATGG - Intergenic
987572990 5:19688345-19688367 CTGGGGAAGAGGATTCTAGATGG - Intronic
987578254 5:19757680-19757702 TTGGGGAAGAGTTATGTGGGTGG - Intronic
987657060 5:20821020-20821042 TTGGGGAAGAGGTATGTGGCTGG - Intergenic
987829453 5:23076606-23076628 CTGGCTAAGAGGTATGTATATGG - Intergenic
988079743 5:26400797-26400819 TTGGAGAAGAGGTATGTGTATGG - Intergenic
988107837 5:26773175-26773197 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988188869 5:27901871-27901893 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988228302 5:28443184-28443206 TGGGGGAAGAGGTATGTGAATGG - Intergenic
988562217 5:32291467-32291489 TTGGGGAAGAGTTATATGGATGG + Intronic
988766491 5:34382928-34382950 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
989045118 5:37266961-37266983 TTGGGGAAGAGGTATGCGGATGG - Intergenic
989307413 5:39973993-39974015 TTGGGGAAGAGGCATGTGGATGG - Intergenic
989457561 5:41661138-41661160 TTGGGGAAGAAGTATGTGGATGG - Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990343096 5:54844369-54844391 ATGAGGATGAGATATGTGGATGG - Intergenic
991013709 5:61910258-61910280 TTGGGGAAGAGGTTTGTGGATGG - Intergenic
991033639 5:62106553-62106575 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
991234248 5:64375796-64375818 TTGGGAAAGAGGAATTTGGATGG + Intergenic
991298119 5:65102784-65102806 TTGGGGAGGAGGCGTGTGGAGGG - Intergenic
991330653 5:65489054-65489076 TTGGGGAAGAGGTATGTGGATGG - Intergenic
991569289 5:68037426-68037448 CTGGATAAGAGGTATGTTGGTGG - Intergenic
991628862 5:68633884-68633906 CTGGGGTAGGGGTTTGCGGAAGG + Intergenic
991955261 5:71987870-71987892 GTGGGGTAGAGGCTTGTGGATGG + Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992243040 5:74790482-74790504 TTGGGGAAGAGGTATGTGGATGG + Intronic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
993203479 5:84848171-84848193 TTGGGGAAGAGATATGTGGATGG + Intergenic
993231825 5:85246909-85246931 TTGGTGAAGAGATATGTGGATGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
993442180 5:87970851-87970873 TTGGGGAAAAGGGATTTGGAGGG - Intergenic
993780773 5:92063021-92063043 TTGGGGAAGAGTTATATGAACGG + Intergenic
993791865 5:92219538-92219560 TTGGAGAAGAGTTATGTGGATGG + Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994605204 5:101958437-101958459 CTGGGTATGAGGTATGAGGCAGG - Intergenic
994958170 5:106562034-106562056 CTGGAGAAGAGGCATGGGAATGG + Intergenic
994984330 5:106915098-106915120 TTGGGGAAGAGGTACGTGGATGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995427644 5:112043096-112043118 TTGGGGAAGAGGTATGTAGATGG - Intergenic
995456457 5:112357803-112357825 CTAGGGAAGAGCTATGTGGATGG + Intronic
995776197 5:115727068-115727090 TTGGGGAAGAGTTATGTAGATGG - Intergenic
995777149 5:115735789-115735811 CTGAGGAAGAGATCTGTGGTGGG + Intergenic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996018646 5:118568490-118568512 TTGGGGAAGAGGTATGTGGATGG + Intergenic
996164876 5:120211887-120211909 TTGGGGAAGAGGTATGTGTATGG - Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996774492 5:127119303-127119325 CTGGGGTAGAGGCATGTGGATGG + Intergenic
996825652 5:127678470-127678492 TTGGGGAAGAGGTATGTGGATGG + Intergenic
997668592 5:135651899-135651921 CTGGGGAAGATATATATGGATGG + Intergenic
997857726 5:137388381-137388403 CAGGGTAAGGGGTATGTGGCGGG + Intronic
998290248 5:140907924-140907946 TTGGGGAAAAGGTATGTGAATGG - Intronic
998327242 5:141292173-141292195 CTGTGGAAAATGTATATGGAAGG + Intergenic
999351457 5:150875464-150875486 TTGGGAAATAGGTATGTGGATGG + Intronic
999384436 5:151144406-151144428 CTGGGGCAGGGGTGTGTGGGCGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000223589 5:159236899-159236921 CTGGAGAACAGGTATCGGGATGG - Intergenic
1000417055 5:160994530-160994552 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001568449 5:172715147-172715169 CTGGGGAAGTGGGATGGGAAGGG + Intergenic
1001717604 5:173829299-173829321 TGGGGGAAGAGATGTGTGGATGG - Intergenic
1001838889 5:174856353-174856375 CTGGGAAAGAAATATGTGAATGG + Intergenic
1002998055 6:2305389-2305411 TTGGGGAAGAGGTATGCAGATGG + Intergenic
1003695808 6:8405520-8405542 TTGGGGAAGAAGTATGTGGAGGG - Intergenic
1003758698 6:9150709-9150731 TTGGGGAAGAGGTATGTGGAGGG + Intergenic
1003791317 6:9550676-9550698 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1003863592 6:10343786-10343808 CAGGGGAACAGGTAGGGGGAAGG - Intergenic
1004275749 6:14233764-14233786 CTGAGGAAGAGAAATTTGGAAGG + Intergenic
1004824205 6:19402603-19402625 TTGGGGAAGAGATATGTGGATGG - Intergenic
1005185259 6:23157694-23157716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1005214084 6:23504632-23504654 CTGGAGAAGAAGTAAGTGTACGG - Intergenic
1005622761 6:27635289-27635311 CTGGAGAACAGGCATGGGGATGG - Intergenic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005721981 6:28611614-28611636 GTGGGGAAGAAGTATGTAGAGGG - Intronic
1006001637 6:30969703-30969725 GTGGGAAAGAGTTATGTGGATGG + Intergenic
1006062434 6:31433842-31433864 TTGGGGAAGAGGTTTGTGGATGG + Intergenic
1006404874 6:33839079-33839101 CTGGGGAAGAGGAGTGGGGGTGG - Intergenic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007775880 6:44223991-44224013 CTGGCGGAGGGGTATGGGGATGG + Intronic
1008079291 6:47177940-47177962 TTGGGGAAGAGGCATGTGGATGG - Intergenic
1008340360 6:50356996-50357018 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1008400371 6:51056095-51056117 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1008545025 6:52576765-52576787 CTGGGGAGGAGGGAGCTGGAGGG - Intronic
1008996329 6:57664470-57664492 TTGGGGAAGAGGTATGTTGATGG + Intergenic
1009184848 6:60563263-60563285 TTGGGGAAGAGGTATGTTGATGG + Intergenic
1009347178 6:62628113-62628135 CAGGTGAAGAGGTAACTGGAGGG - Intergenic
1009390021 6:63134445-63134467 TTGGGGAAATGGTATGGGGATGG - Intergenic
1009660602 6:66606300-66606322 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1009851835 6:69208326-69208348 TTGGGGAAGAGGTATGTTGGTGG - Intronic
1010016065 6:71105844-71105866 CTGGGGAAGAGACATGGGGAGGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010325245 6:74555969-74555991 TTGGGGAACAGGTATGCGGATGG - Intergenic
1010390639 6:75332736-75332758 CTGTGGGAGGTGTATGTGGAAGG - Intronic
1010516745 6:76782406-76782428 AAAGGGAAGAGGTATGTTGATGG + Intergenic
1010818713 6:80389036-80389058 TTGGGGAAGAGATATGTGGATGG + Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012730546 6:102874944-102874966 TTAGGAAAGAGATATGTGGATGG + Intergenic
1012837337 6:104286235-104286257 TTGGGGAAGATGTATGTTCAAGG - Intergenic
1013391100 6:109687272-109687294 CTGGGGAAGAAGCATGTGATTGG + Intronic
1013406754 6:109850430-109850452 TTGGGGAACAGGTATGTGGATGG + Intergenic
1013605166 6:111740670-111740692 CTGGGGAGGAGGTGTGAAGAGGG - Intronic
1014363317 6:120507723-120507745 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1014417074 6:121196018-121196040 TTGGGGAAGAAGTATGTGGATGG + Intronic
1014534102 6:122595974-122595996 TTGCAGAAGAGGTAAGTGGATGG - Intronic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1014631728 6:123797430-123797452 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015275977 6:131383848-131383870 CTGGTGAAGAGGGCTGTTGAAGG + Intergenic
1015300303 6:131645321-131645343 CTGGTGGAGAGGTAAGTTGAAGG - Intronic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015502389 6:133947931-133947953 GTGGGAAAGAGATATCTGGAAGG - Intergenic
1015543916 6:134343226-134343248 GTGGGGAAGAGTTCTGTGGTTGG + Intergenic
1015562710 6:134533807-134533829 CTGGTGAAAAGGTAGGTTGATGG + Intergenic
1015937634 6:138418953-138418975 CTGGGGTAGAGGCATGTGGATGG + Exonic
1016119841 6:140332063-140332085 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1016147240 6:140692084-140692106 TTGGGGAAGAGATATGTAGATGG - Intergenic
1016419528 6:143870040-143870062 TTGGGGAAGAGGTATGTGGATGG - Intronic
1016576177 6:145571959-145571981 TTGGGGAATAGGTAGGTGGATGG - Intronic
1017227718 6:152040462-152040484 TTGGGGAAGAGGTATGTGGATGG - Intronic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017491890 6:154952335-154952357 CAGGGGAAGAAGGATATGGAAGG - Intronic
1017846681 6:158264568-158264590 CTGGGGAAGATGCACCTGGAGGG + Intronic
1017931518 6:158959464-158959486 CTGGGGAGGGAGTCTGTGGAAGG + Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018534941 6:164809870-164809892 TTGGGGAACAGGTAGGTGGATGG - Intergenic
1018586079 6:165360626-165360648 CTGGGGAAGAGGTGGCTGGGAGG + Intronic
1018599978 6:165528166-165528188 TTGGGGAAGAGGTATGTGGATGG + Intronic
1018738989 6:166713066-166713088 CTTGGGAAGAAGCATGGGGAAGG - Intronic
1019040721 6:169102043-169102065 TTAGGGAAAAGGTATTTGGATGG + Intergenic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1020396806 7:7726139-7726161 TTGGGGAAGAGATATGTGGATGG + Intronic
1021957466 7:25840344-25840366 CTGGAGAAGAGGTGTGAGGGAGG - Intergenic
1022046025 7:26623230-26623252 CATGGGGAGAGGTGTGTGGATGG - Intergenic
1022078973 7:27000960-27000982 TTGGGGAAGAGGTATGTGTATGG + Intergenic
1022933801 7:35151485-35151507 CTAGGGAAGTGGTGTATGGAGGG - Intergenic
1024032057 7:45469560-45469582 CTAGAGAATATGTATGTGGATGG + Intergenic
1024040627 7:45550776-45550798 TTGGGGAGGAGGTATATAGATGG + Intergenic
1024201212 7:47108131-47108153 CTGGGAAAGTGGTATGTTTATGG + Intergenic
1024486446 7:49925680-49925702 CTGAGGCAGAGGCCTGTGGATGG - Intronic
1024641667 7:51334000-51334022 CTGGGAAAGAAATATGTGGTAGG - Intergenic
1024743082 7:52376238-52376260 CTGAGTAAGAGGCGTGTGGATGG + Intergenic
1024744297 7:52389053-52389075 CCGGGGAAGAGGTATGTGGATGG + Intergenic
1024866186 7:53906975-53906997 TTGGGGAAGAGGTATGTGAATGG + Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027685888 7:81278586-81278608 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1027820720 7:83040564-83040586 CTGGGGAAGAGACAGCTGGAAGG - Intronic
1028042923 7:86079777-86079799 CTGGGGTAGAGGTGTATAGATGG - Intergenic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028652055 7:93160989-93161011 CTGGGGAAGAGGCATATGAATGG + Intergenic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1028935103 7:96455694-96455716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1030192359 7:106822293-106822315 TTGGGGAAGAGATATGTGGATGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030368839 7:108674658-108674680 TTTGGGAAGAAGTATATGGATGG + Intergenic
1030378001 7:108776030-108776052 CTGATGAAGAGTTCTGTGGATGG - Intergenic
1030457377 7:109792421-109792443 TTGGGGAAGGGATATGTGAATGG - Intergenic
1030740715 7:113106267-113106289 GTGGGGAGAAGGGATGTGGATGG - Intergenic
1031236914 7:119188654-119188676 TTGGGGAAGAAATATGTGGATGG + Intergenic
1031474364 7:122204729-122204751 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
1031682123 7:124687980-124688002 TTGGGGAAGAGATATGTGGATGG + Intergenic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1032153014 7:129446330-129446352 TGGGGAAAGAAGTATGTGGATGG - Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032768421 7:135023409-135023431 CTAGGGAAGAGGCAAGTGAAGGG + Intronic
1032923396 7:136575499-136575521 TTAGGGAAGAGGTATGTGGATGG - Intergenic
1033012240 7:137635010-137635032 CTAGGGAAGAGGTATAAGGAAGG + Intronic
1033076346 7:138253675-138253697 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1033392309 7:140939730-140939752 TTGGGGAAGAGATATGTGGGTGG + Intergenic
1033559927 7:142521528-142521550 ATGGTGGAGAGGTAAGTGGAGGG + Intergenic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1033804207 7:144936446-144936468 ATGAGGAAGAGGAATGTGGGTGG - Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034218813 7:149428800-149428822 CTTAGGAAGAGGCATGAGGAGGG + Intergenic
1034477946 7:151298534-151298556 AAGGGGAAGAGGTATGCTGATGG + Intergenic
1034610495 7:152363544-152363566 CTGGGCAACAGGTATGGCGAAGG + Intronic
1034782610 7:153894668-153894690 CTGGGGAAGAGGTCGGGGGCAGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1036272422 8:7319517-7319539 GTGGGGAAAAGGGATGTGGGAGG - Intergenic
1036348926 8:7990823-7990845 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1036409804 8:8489003-8489025 CTGGGGTGGAGGTAGGGGGATGG - Intergenic
1036787413 8:11697460-11697482 CTGGGGAAGCGGTGTTCGGAGGG + Intronic
1036807709 8:11846919-11846941 CTGGGGAAGAGGGCTGTGTGGGG - Intronic
1036844187 8:12151300-12151322 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1036865561 8:12393621-12393643 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1037769399 8:21789751-21789773 CTGGGGAAGGGGCATCTCGAAGG - Intronic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1038255602 8:25948239-25948261 CTGGGGTGGAGGTATGCGGCAGG - Intronic
1038269283 8:26062169-26062191 CTGGGAAAGAGGCCTGTGGTTGG - Intergenic
1038454367 8:27663008-27663030 TTAGGGAAGAGGTCTGTGGACGG - Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1041934633 8:63321960-63321982 TTGGGGAAGAGGTATGTAGATGG + Intergenic
1041986269 8:63925098-63925120 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1042000978 8:64123366-64123388 TCGGGGAAGAGGTATGTGGATGG - Intergenic
1042076280 8:64998501-64998523 CTGAGGAAGAGGAATTTGGTGGG - Intergenic
1042162378 8:65910044-65910066 CTGGGGAAGATACATGTGGATGG - Intergenic
1042220816 8:66472236-66472258 CTGGGGAGTAGGTATGAGAAAGG + Intronic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043258012 8:78159447-78159469 TTGGGAAAGATGTATGTGGATGG + Intergenic
1044150882 8:88773702-88773724 ATAGGAAAGAGGTATGTGGATGG + Intergenic
1044197420 8:89394620-89394642 GTGGGGAAAAGATGTGTGGATGG - Intergenic
1044202477 8:89453118-89453140 TTGGGGAAGAGGTACGTGGATGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044487073 8:92766553-92766575 TTGCAGAAGAGGTATGTGGATGG - Intergenic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1044633063 8:94297774-94297796 CTGGGGAAGAGGTATGTGAATGG - Intergenic
1044869924 8:96608653-96608675 CTGGCGAAGAGGTAGGTTGAGGG - Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046417555 8:113937164-113937186 TTGGGGTAGAGGTATGTGGATGG - Intergenic
1047198807 8:122746150-122746172 CTGGGAAAGAGGATTTTGGAGGG - Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047805149 8:128351746-128351768 GTGGGGCTGAGGTGTGTGGAGGG - Intergenic
1047884239 8:129230938-129230960 CAGGGGAAGAGGCATGTAGATGG + Intergenic
1048094468 8:131276391-131276413 CTGAGGAAGAGTCCTGTGGAGGG - Intergenic
1048296599 8:133219285-133219307 CTGTGGGAGAGGTCTGAGGAGGG - Intronic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048919350 8:139213707-139213729 CTGGCTTAGAGGGATGTGGAGGG - Intergenic
1049070605 8:140352690-140352712 CTGGGGAAGGGGTGAGTGGGAGG - Intronic
1049202060 8:141345134-141345156 CAGGGGAAGAGGGAAGTGAATGG + Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050124526 9:2342920-2342942 CTGGGAAAAAGGTATGTGGATGG + Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1050888656 9:10796111-10796133 CTGGGGAAGAGGTATGTAAATGG - Intergenic
1050901868 9:10960262-10960284 TTGAGGAAGAGGTATGTGGATGG + Intergenic
1051475889 9:17508901-17508923 CTGGAGAAGAGGTTTTTAGATGG + Intergenic
1051702729 9:19841704-19841726 CTGGGGAAGAGGTATATGGCTGG + Intergenic
1051966115 9:22831938-22831960 CTGGAGAACAGGTATGGGAATGG + Intergenic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1052227670 9:26109000-26109022 TTGGGGAAGAGGTATGTGGATGG + Intronic
1052368736 9:27641465-27641487 GTGAGGAAGAGGTATGTGGATGG + Intergenic
1052442182 9:28511661-28511683 TTGGGGAAGAGGTATGTGAATGG - Intronic
1052489661 9:29149597-29149619 CTAGGGAAGAGGTGAGTGAAGGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052737256 9:32354949-32354971 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1053605949 9:39658657-39658679 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1053863867 9:42415281-42415303 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1054247596 9:62683759-62683781 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054561712 9:66718286-66718308 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1055808922 9:80128416-80128438 CTGGAGAACAGGAATGTGCACGG + Intergenic
1055903851 9:81270563-81270585 GTGAGGAGGAGGTATGTGGATGG - Intergenic
1056156760 9:83845833-83845855 TTGGGGAAGAGGTATGTGGATGG + Intronic
1056314145 9:85372317-85372339 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056353776 9:85777693-85777715 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056365537 9:85900760-85900782 TTGGGGAAGAAGTAGGTGAATGG - Intergenic
1056848646 9:90062101-90062123 ATAGGGAAGAGGTAGGTGGCAGG - Intergenic
1056888099 9:90463545-90463567 ATGGGGAAGAGATTTGTTGAGGG + Intergenic
1056923845 9:90815404-90815426 CTGGGGCAGAGATGTGTGGTTGG + Intronic
1057316285 9:93970834-93970856 CTGGAGAACAGGCATGGGGATGG + Intergenic
1058259175 9:102809056-102809078 TTGGGGAAGAGCTATGTGGATGG - Intergenic
1058347370 9:103980091-103980113 CTGGCGAAGAGATGTGTGGATGG - Intergenic
1058544088 9:106042125-106042147 TTGGGGAAAAGGTATGTAGATGG - Intergenic
1059196415 9:112375214-112375236 TTGGGGAAGAGGTATGTAGATGG - Intergenic
1059254623 9:112918364-112918386 CTGAGGAAGAGCTATGCAGAAGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059766613 9:117389566-117389588 CTGGGGAAGAGCTAAATGGCTGG - Intronic
1060178869 9:121517927-121517949 TTGAGGAAGAGTTATGTGGACGG + Intergenic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060434692 9:123583341-123583363 CTGGGGAAGAGGCATAGAGAAGG + Intronic
1060472448 9:123959513-123959535 GTGGGAAAGAGGAATTTGGATGG - Intergenic
1060736780 9:126071186-126071208 CAGAGGAAGAGGTAGCTGGAAGG - Intergenic
1060805681 9:126574691-126574713 CTGGGGAACATGTATGGGGATGG - Intergenic
1061042968 9:128150241-128150263 CAGGGGAAGTGGTATGTGGTAGG + Exonic
1061325564 9:129861806-129861828 CTGGGGAAGTTGTACGTGCAAGG + Intronic
1062061312 9:134496814-134496836 CTGGGGGAGAGGTGTGCAGATGG - Intergenic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062145997 9:134989964-134989986 CTGGGGGAGAGGTGGGTGAAAGG + Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062180308 9:135187802-135187824 TTGGGGAATAGGTATGCAGATGG - Intergenic
1062627772 9:137450924-137450946 AAGGGGAAGAGGCGTGTGGAGGG - Intronic
1062627812 9:137451068-137451090 AAGGGGAAGAGGCGTGTGGAGGG - Intronic
1062627876 9:137451302-137451324 AAGGGGAAGAGGCGTGTGGAGGG - Intronic
1062627958 9:137451592-137451614 AAGGGGAAGAGGCGTGTGGAGGG - Intronic
1185648132 X:1629492-1629514 CTGGGGCTGAGCTCTGTGGATGG + Intronic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186384008 X:9091133-9091155 TTGGGGAAGAGGTATGTGGATGG - Intronic
1186469682 X:9811506-9811528 TCGGGGATGAGGTATGTGGATGG - Intronic
1186726991 X:12367779-12367801 CTAGTGAAGAGTTTTGTGGAAGG + Intronic
1187524007 X:20037756-20037778 TTGGGGAAGAGATATGTGGATGG + Intronic
1187864934 X:23715371-23715393 CTGGGGAATAGGGATGGGGGAGG - Intronic
1187933953 X:24318109-24318131 CTGGTGAAGAAGTCTATGGAGGG + Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1188972918 X:36639110-36639132 CTGGGCAAGAGACATGTGGATGG + Intergenic
1189125008 X:38436793-38436815 CTTGGGTAGGGGTATGTAGATGG + Intronic
1189154797 X:38746105-38746127 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189911671 X:45816414-45816436 CTGGGTAAGAATTATGTGGGAGG - Intergenic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190002849 X:46706324-46706346 CATGGGAAGAGGTAGCTGGAAGG + Intronic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191094633 X:56661393-56661415 CTGGTGAAGAGTTATGGGAATGG + Intergenic
1191133951 X:57043859-57043881 TTGGGGATGAGGTATGTGGATGG - Intergenic
1191658714 X:63629180-63629202 TTGGGGAAGAGGTATGTTGATGG - Intergenic
1191659108 X:63632291-63632313 CTGGAGAACAGGTATGGGAATGG - Intergenic
1191719155 X:64215085-64215107 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191759436 X:64630537-64630559 TTGGAGGAGAGGTATGTGGATGG + Intergenic
1191769412 X:64739470-64739492 TTGGGGAAGACGTCTGTGGATGG - Intergenic
1191941178 X:66483251-66483273 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1191946434 X:66539647-66539669 CTGGGGAAGAGGTATGTGGCTGG + Intergenic
1192141670 X:68651665-68651687 CAGCTGAAGAGGTATGAGGAGGG + Intronic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1192661486 X:73047153-73047175 TTGGGGAAGAGGTATGTGAATGG - Intergenic
1192898791 X:75472533-75472555 TTGGGGAAGAGGTATGTGGATGG + Intronic
1192996271 X:76516203-76516225 TTAGGGAAGAGGTATGTCGATGG + Intergenic
1193288019 X:79736858-79736880 TTGGGGAGGAGGTACCTGGATGG + Intergenic
1193447239 X:81619388-81619410 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1193573626 X:83174548-83174570 TTGGAGAAGAGGTATTTGGATGG - Intergenic
1193904561 X:87226445-87226467 TTGAAGAAGAGGTATATGGATGG + Intergenic
1194209982 X:91060055-91060077 CTGGAGAACAGGTATGGGAATGG + Intergenic
1194210358 X:91062977-91062999 GTGGGGAAGAAGTATGTAGATGG + Intergenic
1194232948 X:91346914-91346936 TTGGGGAAGAGGTATGTAGACGG + Intergenic
1194343394 X:92731712-92731734 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1194443624 X:93961731-93961753 TTGGGGAAGAAATATGGGGATGG + Intergenic
1194485198 X:94477952-94477974 GTGGAGAGGAGGTATATGGATGG + Intergenic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1194692207 X:97000898-97000920 TTGGGGAAGTGGTATGTGACAGG - Intronic
1194834036 X:98659426-98659448 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1194849163 X:98851540-98851562 TTGAGGAAGAGGTATGTGAATGG - Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195748847 X:108144735-108144757 TTGGGGAAGAGGTATGTGGATGG - Intronic
1195782267 X:108479237-108479259 TTGGGAAAGAGGTATGTGGATGG - Intronic
1195809702 X:108816222-108816244 TTGGGGAAAAGGTATGTGGATGG - Intergenic
1196135877 X:112209213-112209235 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1196761744 X:119207070-119207092 ATGGGGTAAAGGAATGTGGATGG + Intergenic
1197002381 X:121453545-121453567 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1197044508 X:121978938-121978960 TTGGGGAAGAGGTGTGTGAATGG + Intergenic
1197084118 X:122452872-122452894 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197097498 X:122613037-122613059 TTGGGGAAGAAGTATGCGGATGG + Intergenic
1197182179 X:123548408-123548430 TTGGGGAAGAGGTCTGTGGATGG + Intergenic
1197244963 X:124158365-124158387 TTGGGGAAGAGGTATGTGGATGG - Intronic
1197371970 X:125637239-125637261 TCGAGGAAGAGGTATGTGGATGG - Intergenic
1197379921 X:125727277-125727299 TTGTGGAAGAGGTATGTAGATGG - Intergenic
1197386688 X:125811616-125811638 TTGGGGAAGAGGTCTGTGGATGG - Intergenic
1197409245 X:126095818-126095840 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197419966 X:126226959-126226981 TTGGGGAAGAGATCTCTGGATGG + Intergenic
1197476758 X:126934280-126934302 GTGAGGGAGAGGTATGGGGATGG - Intergenic
1197477284 X:126940805-126940827 TTGAGGAAGAGGTCTGTGGATGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197744321 X:129920812-129920834 TTGGGGAAGAGCCATGAGGATGG + Intronic
1198263006 X:134983250-134983272 TTGGGGAAGTGGTATGTGGTTGG - Intergenic
1198605403 X:138331931-138331953 CTGGGGTAAAGCCATGTGGATGG - Intergenic
1198701389 X:139400924-139400946 CTGGGGAAGAGGTATATGGATGG + Intergenic
1198782960 X:140257184-140257206 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1199013181 X:142780903-142780925 ATGAGGAAGAGTTTTGTGGATGG + Intergenic
1199024094 X:142917413-142917435 CTGGGGAACAGGTATTGGAATGG + Intergenic
1199024464 X:142920347-142920369 TTGGGGAAGAGATGTGTGGATGG + Intergenic
1199116492 X:143998633-143998655 TTTGGGAAGAAGTATGTGGATGG - Intergenic
1199144368 X:144348348-144348370 TTAAGGAAGAGGTATGTGGCTGG - Intergenic
1199198546 X:145060240-145060262 CTAAGGAAGAGGCATGTGAATGG + Intergenic
1199275772 X:145940174-145940196 CTGGGGAACAGGCATGGGAATGG + Intergenic
1199310350 X:146313773-146313795 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1199315599 X:146374097-146374119 CTGGGGAAGATGTAACTGAAAGG - Intergenic
1199547937 X:149027786-149027808 TTTGGGGAGGGGTATGTGGAAGG - Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1199924180 X:152445267-152445289 GGGGGGAAGATGTATGTGAAGGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200357192 X:155564326-155564348 CTGGGGAAAAGATATGTGAGGGG + Intronic
1200521351 Y:4212654-4212676 TTGGGTAAGAATTATGTGGATGG + Intergenic
1200651748 Y:5848377-5848399 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1200745969 Y:6904244-6904266 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1200973050 Y:9177078-9177100 TTGGGGAAAAGATAAGTGGATGG - Intergenic
1200976691 Y:9219064-9219086 TTTGGGAAAAGGTATGTGCAGGG + Intergenic
1200986175 Y:9304967-9304989 GTGGGGAAGTGGTCTGTGAAAGG - Intergenic
1201529578 Y:14977281-14977303 TTGGGGAAGACCTATATGGAAGG - Intergenic
1201796583 Y:17903010-17903032 TTGAGGAAGAGGTATGTGGACGG - Intergenic
1201804972 Y:18002975-18002997 TTGAGGAAGAGGTATGTGGACGG + Intergenic
1202134480 Y:21647478-21647500 TTTGGGAAAAGGTATGTGCAGGG - Intergenic
1202138029 Y:21687427-21687449 TTGGGGAAAAGATAAGTGGATGG + Intergenic
1202341346 Y:23872180-23872202 CTGGAGAACAGGCATGGGGATGG - Intergenic
1202357968 Y:24072072-24072094 TTGAGGAAGACGTATGTGGACGG - Intergenic
1202512810 Y:25598041-25598063 TTGAGGAAGACGTATGTGGACGG + Intergenic
1202529420 Y:25797906-25797928 CTGGAGAACAGGCATGGGGATGG + Intergenic