ID: 1012002257

View in Genome Browser
Species Human (GRCh38)
Location 6:93667593-93667615
Sequence TTGCAAGTCCCAGAGTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012002257_1012002259 9 Left 1012002257 6:93667593-93667615 CCTTTAAACTCTGGGACTTGCAA No data
Right 1012002259 6:93667625-93667647 CCCAGAGACTCTTAGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012002257 Original CRISPR TTGCAAGTCCCAGAGTTTAA AGG (reversed) Intergenic
No off target data available for this crispr