ID: 1012002259

View in Genome Browser
Species Human (GRCh38)
Location 6:93667625-93667647
Sequence CCCAGAGACTCTTAGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012002257_1012002259 9 Left 1012002257 6:93667593-93667615 CCTTTAAACTCTGGGACTTGCAA No data
Right 1012002259 6:93667625-93667647 CCCAGAGACTCTTAGTCCTCTGG No data
1012002254_1012002259 22 Left 1012002254 6:93667580-93667602 CCAGGTTCTTCAGCCTTTAAACT No data
Right 1012002259 6:93667625-93667647 CCCAGAGACTCTTAGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012002259 Original CRISPR CCCAGAGACTCTTAGTCCTC TGG Intergenic
No off target data available for this crispr