ID: 1012012212

View in Genome Browser
Species Human (GRCh38)
Location 6:93803580-93803602
Sequence TCTAGCAAAAAGATTTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012012208_1012012212 12 Left 1012012208 6:93803545-93803567 CCCCATTTAAGTTATGTCAACTG No data
Right 1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG No data
1012012207_1012012212 24 Left 1012012207 6:93803533-93803555 CCAAGATGGAGACCCCATTTAAG No data
Right 1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG No data
1012012206_1012012212 25 Left 1012012206 6:93803532-93803554 CCCAAGATGGAGACCCCATTTAA No data
Right 1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG No data
1012012210_1012012212 10 Left 1012012210 6:93803547-93803569 CCATTTAAGTTATGTCAACTGTT No data
Right 1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG No data
1012012209_1012012212 11 Left 1012012209 6:93803546-93803568 CCCATTTAAGTTATGTCAACTGT No data
Right 1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012012212 Original CRISPR TCTAGCAAAAAGATTTTGTT TGG Intergenic
No off target data available for this crispr