ID: 1012014594

View in Genome Browser
Species Human (GRCh38)
Location 6:93834793-93834815
Sequence CTGCTAGGAGTGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012014589_1012014594 1 Left 1012014589 6:93834769-93834791 CCTCCTCTAGAAAAGCGGGACTT 0: 25
1: 77
2: 159
3: 300
4: 345
Right 1012014594 6:93834793-93834815 CTGCTAGGAGTGAAGGAGAAGGG No data
1012014587_1012014594 3 Left 1012014587 6:93834767-93834789 CCCCTCCTCTAGAAAAGCGGGAC 0: 24
1: 70
2: 159
3: 291
4: 343
Right 1012014594 6:93834793-93834815 CTGCTAGGAGTGAAGGAGAAGGG No data
1012014590_1012014594 -2 Left 1012014590 6:93834772-93834794 CCTCTAGAAAAGCGGGACTTGCT 0: 27
1: 165
2: 385
3: 261
4: 165
Right 1012014594 6:93834793-93834815 CTGCTAGGAGTGAAGGAGAAGGG No data
1012014588_1012014594 2 Left 1012014588 6:93834768-93834790 CCCTCCTCTAGAAAAGCGGGACT 0: 24
1: 78
2: 166
3: 299
4: 387
Right 1012014594 6:93834793-93834815 CTGCTAGGAGTGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012014594 Original CRISPR CTGCTAGGAGTGAAGGAGAA GGG Intergenic
No off target data available for this crispr