ID: 1012018862

View in Genome Browser
Species Human (GRCh38)
Location 6:93890266-93890288
Sequence TCCAGGTGGTTTGAAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012018856_1012018862 23 Left 1012018856 6:93890220-93890242 CCTATGGCTTTGAAAGCCTCCAG No data
Right 1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG No data
1012018858_1012018862 7 Left 1012018858 6:93890236-93890258 CCTCCAGTAGGCATCTTGCAATG No data
Right 1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG No data
1012018855_1012018862 24 Left 1012018855 6:93890219-93890241 CCCTATGGCTTTGAAAGCCTCCA No data
Right 1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG No data
1012018859_1012018862 4 Left 1012018859 6:93890239-93890261 CCAGTAGGCATCTTGCAATGACT No data
Right 1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012018862 Original CRISPR TCCAGGTGGTTTGAAAATGC TGG Intergenic
No off target data available for this crispr