ID: 1012018862 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:93890266-93890288 |
Sequence | TCCAGGTGGTTTGAAAATGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012018856_1012018862 | 23 | Left | 1012018856 | 6:93890220-93890242 | CCTATGGCTTTGAAAGCCTCCAG | No data | ||
Right | 1012018862 | 6:93890266-93890288 | TCCAGGTGGTTTGAAAATGCTGG | No data | ||||
1012018858_1012018862 | 7 | Left | 1012018858 | 6:93890236-93890258 | CCTCCAGTAGGCATCTTGCAATG | No data | ||
Right | 1012018862 | 6:93890266-93890288 | TCCAGGTGGTTTGAAAATGCTGG | No data | ||||
1012018855_1012018862 | 24 | Left | 1012018855 | 6:93890219-93890241 | CCCTATGGCTTTGAAAGCCTCCA | No data | ||
Right | 1012018862 | 6:93890266-93890288 | TCCAGGTGGTTTGAAAATGCTGG | No data | ||||
1012018859_1012018862 | 4 | Left | 1012018859 | 6:93890239-93890261 | CCAGTAGGCATCTTGCAATGACT | No data | ||
Right | 1012018862 | 6:93890266-93890288 | TCCAGGTGGTTTGAAAATGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012018862 | Original CRISPR | TCCAGGTGGTTTGAAAATGC TGG | Intergenic | ||
No off target data available for this crispr |