ID: 1012020632

View in Genome Browser
Species Human (GRCh38)
Location 6:93914175-93914197
Sequence GTGAATAAACAGCTTTAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012020630_1012020632 18 Left 1012020630 6:93914134-93914156 CCTACGAAAACTTCAAAATTACA No data
Right 1012020632 6:93914175-93914197 GTGAATAAACAGCTTTAGCGAGG No data
1012020629_1012020632 21 Left 1012020629 6:93914131-93914153 CCTCCTACGAAAACTTCAAAATT No data
Right 1012020632 6:93914175-93914197 GTGAATAAACAGCTTTAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012020632 Original CRISPR GTGAATAAACAGCTTTAGCG AGG Intergenic
No off target data available for this crispr