ID: 1012021380

View in Genome Browser
Species Human (GRCh38)
Location 6:93925351-93925373
Sequence GACTACGACATTGTTCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012021380_1012021384 12 Left 1012021380 6:93925351-93925373 CCCTAAAGAACAATGTCGTAGTC No data
Right 1012021384 6:93925386-93925408 CATAACAAAATATTATGAATTGG No data
1012021380_1012021385 13 Left 1012021380 6:93925351-93925373 CCCTAAAGAACAATGTCGTAGTC No data
Right 1012021385 6:93925387-93925409 ATAACAAAATATTATGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012021380 Original CRISPR GACTACGACATTGTTCTTTA GGG (reversed) Intergenic
No off target data available for this crispr