ID: 1012021384 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:93925386-93925408 |
| Sequence | CATAACAAAATATTATGAAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012021381_1012021384 | 11 | Left | 1012021381 | 6:93925352-93925374 | CCTAAAGAACAATGTCGTAGTCA | No data | ||
| Right | 1012021384 | 6:93925386-93925408 | CATAACAAAATATTATGAATTGG | No data | ||||
| 1012021379_1012021384 | 13 | Left | 1012021379 | 6:93925350-93925372 | CCCCTAAAGAACAATGTCGTAGT | No data | ||
| Right | 1012021384 | 6:93925386-93925408 | CATAACAAAATATTATGAATTGG | No data | ||||
| 1012021380_1012021384 | 12 | Left | 1012021380 | 6:93925351-93925373 | CCCTAAAGAACAATGTCGTAGTC | No data | ||
| Right | 1012021384 | 6:93925386-93925408 | CATAACAAAATATTATGAATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012021384 | Original CRISPR | CATAACAAAATATTATGAAT TGG | Intergenic | ||