ID: 1012021385

View in Genome Browser
Species Human (GRCh38)
Location 6:93925387-93925409
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012021379_1012021385 14 Left 1012021379 6:93925350-93925372 CCCCTAAAGAACAATGTCGTAGT No data
Right 1012021385 6:93925387-93925409 ATAACAAAATATTATGAATTGGG No data
1012021381_1012021385 12 Left 1012021381 6:93925352-93925374 CCTAAAGAACAATGTCGTAGTCA No data
Right 1012021385 6:93925387-93925409 ATAACAAAATATTATGAATTGGG No data
1012021380_1012021385 13 Left 1012021380 6:93925351-93925373 CCCTAAAGAACAATGTCGTAGTC No data
Right 1012021385 6:93925387-93925409 ATAACAAAATATTATGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012021385 Original CRISPR ATAACAAAATATTATGAATT GGG Intergenic