ID: 1012023873

View in Genome Browser
Species Human (GRCh38)
Location 6:93962958-93962980
Sequence AATGTGTGTGTCAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012023873_1012023878 27 Left 1012023873 6:93962958-93962980 CCCTCCTCACTGACACACACATT No data
Right 1012023878 6:93963008-93963030 GCAGAGCAAAAGTAGCAGTTTGG No data
1012023873_1012023877 5 Left 1012023873 6:93962958-93962980 CCCTCCTCACTGACACACACATT No data
Right 1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG No data
1012023873_1012023876 -2 Left 1012023873 6:93962958-93962980 CCCTCCTCACTGACACACACATT No data
Right 1012023876 6:93962979-93963001 TTGATGACATTCTATGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012023873 Original CRISPR AATGTGTGTGTCAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr