ID: 1012023874 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:93962959-93962981 |
Sequence | CAATGTGTGTGTCAGTGAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012023874_1012023876 | -3 | Left | 1012023874 | 6:93962959-93962981 | CCTCCTCACTGACACACACATTG | No data | ||
Right | 1012023876 | 6:93962979-93963001 | TTGATGACATTCTATGTAGCAGG | No data | ||||
1012023874_1012023878 | 26 | Left | 1012023874 | 6:93962959-93962981 | CCTCCTCACTGACACACACATTG | No data | ||
Right | 1012023878 | 6:93963008-93963030 | GCAGAGCAAAAGTAGCAGTTTGG | No data | ||||
1012023874_1012023877 | 4 | Left | 1012023874 | 6:93962959-93962981 | CCTCCTCACTGACACACACATTG | No data | ||
Right | 1012023877 | 6:93962986-93963008 | CATTCTATGTAGCAGGAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012023874 | Original CRISPR | CAATGTGTGTGTCAGTGAGG AGG (reversed) | Intergenic | ||
No off target data available for this crispr |