ID: 1012023874

View in Genome Browser
Species Human (GRCh38)
Location 6:93962959-93962981
Sequence CAATGTGTGTGTCAGTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012023874_1012023876 -3 Left 1012023874 6:93962959-93962981 CCTCCTCACTGACACACACATTG No data
Right 1012023876 6:93962979-93963001 TTGATGACATTCTATGTAGCAGG No data
1012023874_1012023878 26 Left 1012023874 6:93962959-93962981 CCTCCTCACTGACACACACATTG No data
Right 1012023878 6:93963008-93963030 GCAGAGCAAAAGTAGCAGTTTGG No data
1012023874_1012023877 4 Left 1012023874 6:93962959-93962981 CCTCCTCACTGACACACACATTG No data
Right 1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012023874 Original CRISPR CAATGTGTGTGTCAGTGAGG AGG (reversed) Intergenic
No off target data available for this crispr