ID: 1012023875

View in Genome Browser
Species Human (GRCh38)
Location 6:93962962-93962984
Sequence CATCAATGTGTGTGTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012023875_1012023879 29 Left 1012023875 6:93962962-93962984 CCTCACTGACACACACATTGATG No data
Right 1012023879 6:93963014-93963036 CAAAAGTAGCAGTTTGGATCCGG No data
1012023875_1012023878 23 Left 1012023875 6:93962962-93962984 CCTCACTGACACACACATTGATG No data
Right 1012023878 6:93963008-93963030 GCAGAGCAAAAGTAGCAGTTTGG No data
1012023875_1012023880 30 Left 1012023875 6:93962962-93962984 CCTCACTGACACACACATTGATG No data
Right 1012023880 6:93963015-93963037 AAAAGTAGCAGTTTGGATCCGGG No data
1012023875_1012023876 -6 Left 1012023875 6:93962962-93962984 CCTCACTGACACACACATTGATG No data
Right 1012023876 6:93962979-93963001 TTGATGACATTCTATGTAGCAGG No data
1012023875_1012023877 1 Left 1012023875 6:93962962-93962984 CCTCACTGACACACACATTGATG No data
Right 1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012023875 Original CRISPR CATCAATGTGTGTGTCAGTG AGG (reversed) Intergenic
No off target data available for this crispr