ID: 1012023877

View in Genome Browser
Species Human (GRCh38)
Location 6:93962986-93963008
Sequence CATTCTATGTAGCAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012023874_1012023877 4 Left 1012023874 6:93962959-93962981 CCTCCTCACTGACACACACATTG No data
Right 1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG No data
1012023875_1012023877 1 Left 1012023875 6:93962962-93962984 CCTCACTGACACACACATTGATG No data
Right 1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG No data
1012023872_1012023877 8 Left 1012023872 6:93962955-93962977 CCACCCTCCTCACTGACACACAC No data
Right 1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG No data
1012023873_1012023877 5 Left 1012023873 6:93962958-93962980 CCCTCCTCACTGACACACACATT No data
Right 1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012023877 Original CRISPR CATTCTATGTAGCAGGAGCA AGG Intergenic
No off target data available for this crispr