ID: 1012026306

View in Genome Browser
Species Human (GRCh38)
Location 6:93996904-93996926
Sequence CCCCATGGCAACCATCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012026306_1012026310 9 Left 1012026306 6:93996904-93996926 CCTCTATGATGGTTGCCATGGGG No data
Right 1012026310 6:93996936-93996958 GTCATTAGATATTGATTTGTGGG No data
1012026306_1012026309 8 Left 1012026306 6:93996904-93996926 CCTCTATGATGGTTGCCATGGGG No data
Right 1012026309 6:93996935-93996957 TGTCATTAGATATTGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012026306 Original CRISPR CCCCATGGCAACCATCATAG AGG (reversed) Intergenic
No off target data available for this crispr