ID: 1012034582

View in Genome Browser
Species Human (GRCh38)
Location 6:94116953-94116975
Sequence CTGCCATTTATGACTCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012034582_1012034585 16 Left 1012034582 6:94116953-94116975 CCCCATTGAGTCATAAATGGCAG No data
Right 1012034585 6:94116992-94117014 TGTATTAGATTTGTTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012034582 Original CRISPR CTGCCATTTATGACTCAATG GGG (reversed) Intergenic
No off target data available for this crispr