ID: 1012044159

View in Genome Browser
Species Human (GRCh38)
Location 6:94248302-94248324
Sequence GAGGAAATTTGGATACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012044159_1012044165 4 Left 1012044159 6:94248302-94248324 CCTGTCTGTATCCAAATTTCCTC No data
Right 1012044165 6:94248329-94248351 TATAAGGGTACCAGTCGTTTGGG No data
1012044159_1012044166 10 Left 1012044159 6:94248302-94248324 CCTGTCTGTATCCAAATTTCCTC No data
Right 1012044166 6:94248335-94248357 GGTACCAGTCGTTTGGGATTAGG No data
1012044159_1012044164 3 Left 1012044159 6:94248302-94248324 CCTGTCTGTATCCAAATTTCCTC No data
Right 1012044164 6:94248328-94248350 ATATAAGGGTACCAGTCGTTTGG No data
1012044159_1012044167 11 Left 1012044159 6:94248302-94248324 CCTGTCTGTATCCAAATTTCCTC No data
Right 1012044167 6:94248336-94248358 GTACCAGTCGTTTGGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012044159 Original CRISPR GAGGAAATTTGGATACAGAC AGG (reversed) Intergenic
No off target data available for this crispr