ID: 1012044164

View in Genome Browser
Species Human (GRCh38)
Location 6:94248328-94248350
Sequence ATATAAGGGTACCAGTCGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012044160_1012044164 -8 Left 1012044160 6:94248313-94248335 CCAAATTTCCTCTTCATATAAGG No data
Right 1012044164 6:94248328-94248350 ATATAAGGGTACCAGTCGTTTGG No data
1012044159_1012044164 3 Left 1012044159 6:94248302-94248324 CCTGTCTGTATCCAAATTTCCTC No data
Right 1012044164 6:94248328-94248350 ATATAAGGGTACCAGTCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012044164 Original CRISPR ATATAAGGGTACCAGTCGTT TGG Intergenic
No off target data available for this crispr