ID: 1012044166

View in Genome Browser
Species Human (GRCh38)
Location 6:94248335-94248357
Sequence GGTACCAGTCGTTTGGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012044160_1012044166 -1 Left 1012044160 6:94248313-94248335 CCAAATTTCCTCTTCATATAAGG No data
Right 1012044166 6:94248335-94248357 GGTACCAGTCGTTTGGGATTAGG No data
1012044163_1012044166 -9 Left 1012044163 6:94248321-94248343 CCTCTTCATATAAGGGTACCAGT No data
Right 1012044166 6:94248335-94248357 GGTACCAGTCGTTTGGGATTAGG No data
1012044159_1012044166 10 Left 1012044159 6:94248302-94248324 CCTGTCTGTATCCAAATTTCCTC No data
Right 1012044166 6:94248335-94248357 GGTACCAGTCGTTTGGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012044166 Original CRISPR GGTACCAGTCGTTTGGGATT AGG Intergenic
No off target data available for this crispr