ID: 1012044167

View in Genome Browser
Species Human (GRCh38)
Location 6:94248336-94248358
Sequence GTACCAGTCGTTTGGGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012044160_1012044167 0 Left 1012044160 6:94248313-94248335 CCAAATTTCCTCTTCATATAAGG No data
Right 1012044167 6:94248336-94248358 GTACCAGTCGTTTGGGATTAGGG No data
1012044163_1012044167 -8 Left 1012044163 6:94248321-94248343 CCTCTTCATATAAGGGTACCAGT No data
Right 1012044167 6:94248336-94248358 GTACCAGTCGTTTGGGATTAGGG No data
1012044159_1012044167 11 Left 1012044159 6:94248302-94248324 CCTGTCTGTATCCAAATTTCCTC No data
Right 1012044167 6:94248336-94248358 GTACCAGTCGTTTGGGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012044167 Original CRISPR GTACCAGTCGTTTGGGATTA GGG Intergenic
No off target data available for this crispr