ID: 1012047286

View in Genome Browser
Species Human (GRCh38)
Location 6:94293965-94293987
Sequence TCTATTAACCAGAAAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012047284_1012047286 14 Left 1012047284 6:94293928-94293950 CCTTTCTCCTCAGTTTTAGAAAT No data
Right 1012047286 6:94293965-94293987 TCTATTAACCAGAAAGTGTATGG No data
1012047285_1012047286 7 Left 1012047285 6:94293935-94293957 CCTCAGTTTTAGAAATTGTATTC No data
Right 1012047286 6:94293965-94293987 TCTATTAACCAGAAAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012047286 Original CRISPR TCTATTAACCAGAAAGTGTA TGG Intergenic
No off target data available for this crispr