ID: 1012047714

View in Genome Browser
Species Human (GRCh38)
Location 6:94300353-94300375
Sequence CGCCTCGTAGCTGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012047714_1012047718 1 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047718 6:94300377-94300399 AAAGAGAAAATTTGTGTGCTTGG No data
1012047714_1012047722 8 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047722 6:94300384-94300406 AAATTTGTGTGCTTGGGGAAGGG No data
1012047714_1012047724 27 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG No data
1012047714_1012047721 7 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047721 6:94300383-94300405 AAAATTTGTGTGCTTGGGGAAGG No data
1012047714_1012047719 2 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047719 6:94300378-94300400 AAGAGAAAATTTGTGTGCTTGGG No data
1012047714_1012047720 3 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047720 6:94300379-94300401 AGAGAAAATTTGTGTGCTTGGGG No data
1012047714_1012047723 26 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047723 6:94300402-94300424 AAGGGAAAGTGCAGTTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012047714 Original CRISPR CGCCTCGTAGCTGCTGCTGG GGG (reversed) Intergenic
No off target data available for this crispr