ID: 1012047716

View in Genome Browser
Species Human (GRCh38)
Location 6:94300355-94300377
Sequence TGCGCCTCGTAGCTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012047716_1012047722 6 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047722 6:94300384-94300406 AAATTTGTGTGCTTGGGGAAGGG No data
1012047716_1012047723 24 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047723 6:94300402-94300424 AAGGGAAAGTGCAGTTATTGTGG No data
1012047716_1012047721 5 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047721 6:94300383-94300405 AAAATTTGTGTGCTTGGGGAAGG No data
1012047716_1012047718 -1 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047718 6:94300377-94300399 AAAGAGAAAATTTGTGTGCTTGG No data
1012047716_1012047719 0 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047719 6:94300378-94300400 AAGAGAAAATTTGTGTGCTTGGG No data
1012047716_1012047720 1 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047720 6:94300379-94300401 AGAGAAAATTTGTGTGCTTGGGG No data
1012047716_1012047724 25 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012047716 Original CRISPR TGCGCCTCGTAGCTGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr