ID: 1012047724

View in Genome Browser
Species Human (GRCh38)
Location 6:94300403-94300425
Sequence AGGGAAAGTGCAGTTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012047714_1012047724 27 Left 1012047714 6:94300353-94300375 CCCCCAGCAGCAGCTACGAGGCG No data
Right 1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG No data
1012047715_1012047724 26 Left 1012047715 6:94300354-94300376 CCCCAGCAGCAGCTACGAGGCGC No data
Right 1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG No data
1012047716_1012047724 25 Left 1012047716 6:94300355-94300377 CCCAGCAGCAGCTACGAGGCGCA No data
Right 1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG No data
1012047717_1012047724 24 Left 1012047717 6:94300356-94300378 CCAGCAGCAGCTACGAGGCGCAA No data
Right 1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012047724 Original CRISPR AGGGAAAGTGCAGTTATTGT GGG Intergenic
No off target data available for this crispr