ID: 1012054894

View in Genome Browser
Species Human (GRCh38)
Location 6:94393823-94393845
Sequence TCACCTCCAAGGGTTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012054894_1012054898 -5 Left 1012054894 6:94393823-94393845 CCATCAGGAACCCTTGGAGGTGA No data
Right 1012054898 6:94393841-94393863 GGTGACTGCCTTACCCTGGCCGG No data
1012054894_1012054897 -9 Left 1012054894 6:94393823-94393845 CCATCAGGAACCCTTGGAGGTGA No data
Right 1012054897 6:94393837-94393859 TGGAGGTGACTGCCTTACCCTGG No data
1012054894_1012054903 10 Left 1012054894 6:94393823-94393845 CCATCAGGAACCCTTGGAGGTGA No data
Right 1012054903 6:94393856-94393878 CTGGCCGGAGCTACCACGGACGG No data
1012054894_1012054900 6 Left 1012054894 6:94393823-94393845 CCATCAGGAACCCTTGGAGGTGA No data
Right 1012054900 6:94393852-94393874 TACCCTGGCCGGAGCTACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012054894 Original CRISPR TCACCTCCAAGGGTTCCTGA TGG (reversed) Intergenic