ID: 1012060275

View in Genome Browser
Species Human (GRCh38)
Location 6:94469568-94469590
Sequence CTGTTGCCCTTCAATCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012060272_1012060275 20 Left 1012060272 6:94469525-94469547 CCAGACAAATGCTGCAAAAGCTA No data
Right 1012060275 6:94469568-94469590 CTGTTGCCCTTCAATCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012060275 Original CRISPR CTGTTGCCCTTCAATCCTGA TGG Intergenic
No off target data available for this crispr