ID: 1012062858

View in Genome Browser
Species Human (GRCh38)
Location 6:94511036-94511058
Sequence GGACCCACGGTGGAGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062858_1012062870 16 Left 1012062858 6:94511036-94511058 CCTGCTCCCTCCACCGTGGGTCC No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062858_1012062868 10 Left 1012062858 6:94511036-94511058 CCTGCTCCCTCCACCGTGGGTCC No data
Right 1012062868 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
1012062858_1012062869 13 Left 1012062858 6:94511036-94511058 CCTGCTCCCTCCACCGTGGGTCC No data
Right 1012062869 6:94511072-94511094 GCTACACCCCCACTCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062858 Original CRISPR GGACCCACGGTGGAGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr