ID: 1012062862

View in Genome Browser
Species Human (GRCh38)
Location 6:94511046-94511068
Sequence CTGGGACCTCGGACCCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062862_1012062870 6 Left 1012062862 6:94511046-94511068 CCACCGTGGGTCCGAGGTCCCAG No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062862_1012062869 3 Left 1012062862 6:94511046-94511068 CCACCGTGGGTCCGAGGTCCCAG No data
Right 1012062869 6:94511072-94511094 GCTACACCCCCACTCCCAGGTGG No data
1012062862_1012062868 0 Left 1012062862 6:94511046-94511068 CCACCGTGGGTCCGAGGTCCCAG No data
Right 1012062868 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
1012062862_1012062877 24 Left 1012062862 6:94511046-94511068 CCACCGTGGGTCCGAGGTCCCAG No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062862 Original CRISPR CTGGGACCTCGGACCCACGG TGG (reversed) Intergenic
No off target data available for this crispr