ID: 1012062863

View in Genome Browser
Species Human (GRCh38)
Location 6:94511049-94511071
Sequence TGGCTGGGACCTCGGACCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062863_1012062877 21 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062863_1012062869 0 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062869 6:94511072-94511094 GCTACACCCCCACTCCCAGGTGG No data
1012062863_1012062870 3 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062863_1012062868 -3 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062868 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
1012062863_1012062879 28 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062863 Original CRISPR TGGCTGGGACCTCGGACCCA CGG (reversed) Intergenic
No off target data available for this crispr