ID: 1012062864

View in Genome Browser
Species Human (GRCh38)
Location 6:94511057-94511079
Sequence GGTGTAGCTGGCTGGGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062864_1012062870 -5 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062864_1012062882 29 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062882 6:94511109-94511131 TCGCTGGCCTGCGGAGAAGGCGG No data
1012062864_1012062880 26 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062880 6:94511106-94511128 TCCTCGCTGGCCTGCGGAGAAGG No data
1012062864_1012062879 20 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062864_1012062869 -8 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062869 6:94511072-94511094 GCTACACCCCCACTCCCAGGTGG No data
1012062864_1012062877 13 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062864_1012062883 30 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062883 6:94511110-94511132 CGCTGGCCTGCGGAGAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062864 Original CRISPR GGTGTAGCTGGCTGGGACCT CGG (reversed) Intergenic
No off target data available for this crispr