ID: 1012062867

View in Genome Browser
Species Human (GRCh38)
Location 6:94511069-94511091
Sequence CCTGGGAGTGGGGGTGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062867_1012062879 8 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062867_1012062882 17 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062882 6:94511109-94511131 TCGCTGGCCTGCGGAGAAGGCGG No data
1012062867_1012062877 1 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062867_1012062883 18 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062883 6:94511110-94511132 CGCTGGCCTGCGGAGAAGGCGGG No data
1012062867_1012062884 19 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062884 6:94511111-94511133 GCTGGCCTGCGGAGAAGGCGGGG No data
1012062867_1012062880 14 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062880 6:94511106-94511128 TCCTCGCTGGCCTGCGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062867 Original CRISPR CCTGGGAGTGGGGGTGTAGC TGG (reversed) Intergenic
No off target data available for this crispr