ID: 1012062870

View in Genome Browser
Species Human (GRCh38)
Location 6:94511075-94511097
Sequence ACACCCCCACTCCCAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062854_1012062870 23 Left 1012062854 6:94511029-94511051 CCTACTCCCTGCTCCCTCCACCG No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062861_1012062870 9 Left 1012062861 6:94511043-94511065 CCTCCACCGTGGGTCCGAGGTCC No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062858_1012062870 16 Left 1012062858 6:94511036-94511058 CCTGCTCCCTCCACCGTGGGTCC No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062857_1012062870 17 Left 1012062857 6:94511035-94511057 CCCTGCTCCCTCCACCGTGGGTC No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062864_1012062870 -5 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062860_1012062870 10 Left 1012062860 6:94511042-94511064 CCCTCCACCGTGGGTCCGAGGTC No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062863_1012062870 3 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data
1012062862_1012062870 6 Left 1012062862 6:94511046-94511068 CCACCGTGGGTCCGAGGTCCCAG No data
Right 1012062870 6:94511075-94511097 ACACCCCCACTCCCAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062870 Original CRISPR ACACCCCCACTCCCAGGTGG AGG Intergenic
No off target data available for this crispr