ID: 1012062871

View in Genome Browser
Species Human (GRCh38)
Location 6:94511078-94511100
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062871_1012062880 5 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062880 6:94511106-94511128 TCCTCGCTGGCCTGCGGAGAAGG No data
1012062871_1012062879 -1 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062871_1012062883 9 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062883 6:94511110-94511132 CGCTGGCCTGCGGAGAAGGCGGG No data
1012062871_1012062877 -8 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062871_1012062884 10 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062884 6:94511111-94511133 GCTGGCCTGCGGAGAAGGCGGGG No data
1012062871_1012062882 8 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062882 6:94511109-94511131 TCGCTGGCCTGCGGAGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062871 Original CRISPR GAGCCTCCACCTGGGAGTGG GGG (reversed) Intergenic
No off target data available for this crispr