ID: 1012062877

View in Genome Browser
Species Human (GRCh38)
Location 6:94511093-94511115
Sequence GGAGGCTCCGAGCTCCTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062866_1012062877 5 Left 1012062866 6:94511065-94511087 CCAGCCAGCTACACCCCCACTCC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062863_1012062877 21 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062862_1012062877 24 Left 1012062862 6:94511046-94511068 CCACCGTGGGTCCGAGGTCCCAG No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062871_1012062877 -8 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062873_1012062877 -10 Left 1012062873 6:94511080-94511102 CCCACTCCCAGGTGGAGGCTCCG No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062867_1012062877 1 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062865_1012062877 6 Left 1012062865 6:94511064-94511086 CCCAGCCAGCTACACCCCCACTC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062864_1012062877 13 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062861_1012062877 27 Left 1012062861 6:94511043-94511065 CCTCCACCGTGGGTCCGAGGTCC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062872_1012062877 -9 Left 1012062872 6:94511079-94511101 CCCCACTCCCAGGTGGAGGCTCC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data
1012062860_1012062877 28 Left 1012062860 6:94511042-94511064 CCCTCCACCGTGGGTCCGAGGTC No data
Right 1012062877 6:94511093-94511115 GGAGGCTCCGAGCTCCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062877 Original CRISPR GGAGGCTCCGAGCTCCTCGC TGG Intergenic
No off target data available for this crispr