ID: 1012062879

View in Genome Browser
Species Human (GRCh38)
Location 6:94511100-94511122
Sequence CCGAGCTCCTCGCTGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012062872_1012062879 -2 Left 1012062872 6:94511079-94511101 CCCCACTCCCAGGTGGAGGCTCC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062873_1012062879 -3 Left 1012062873 6:94511080-94511102 CCCACTCCCAGGTGGAGGCTCCG No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062865_1012062879 13 Left 1012062865 6:94511064-94511086 CCCAGCCAGCTACACCCCCACTC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062875_1012062879 -9 Left 1012062875 6:94511086-94511108 CCCAGGTGGAGGCTCCGAGCTCC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062866_1012062879 12 Left 1012062866 6:94511065-94511087 CCAGCCAGCTACACCCCCACTCC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062876_1012062879 -10 Left 1012062876 6:94511087-94511109 CCAGGTGGAGGCTCCGAGCTCCT No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062874_1012062879 -4 Left 1012062874 6:94511081-94511103 CCACTCCCAGGTGGAGGCTCCGA No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062871_1012062879 -1 Left 1012062871 6:94511078-94511100 CCCCCACTCCCAGGTGGAGGCTC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062863_1012062879 28 Left 1012062863 6:94511049-94511071 CCGTGGGTCCGAGGTCCCAGCCA No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062864_1012062879 20 Left 1012062864 6:94511057-94511079 CCGAGGTCCCAGCCAGCTACACC No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data
1012062867_1012062879 8 Left 1012062867 6:94511069-94511091 CCAGCTACACCCCCACTCCCAGG No data
Right 1012062879 6:94511100-94511122 CCGAGCTCCTCGCTGGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012062879 Original CRISPR CCGAGCTCCTCGCTGGCCTG CGG Intergenic
No off target data available for this crispr