ID: 1012073796

View in Genome Browser
Species Human (GRCh38)
Location 6:94657774-94657796
Sequence AGGGAGAAAGCAGTGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012073796_1012073802 24 Left 1012073796 6:94657774-94657796 CCATCAGTCACTGCTTTCTCCCT No data
Right 1012073802 6:94657821-94657843 CACTATAGGACCACTGCCATTGG No data
1012073796_1012073803 28 Left 1012073796 6:94657774-94657796 CCATCAGTCACTGCTTTCTCCCT No data
Right 1012073803 6:94657825-94657847 ATAGGACCACTGCCATTGGTAGG No data
1012073796_1012073804 29 Left 1012073796 6:94657774-94657796 CCATCAGTCACTGCTTTCTCCCT No data
Right 1012073804 6:94657826-94657848 TAGGACCACTGCCATTGGTAGGG No data
1012073796_1012073805 30 Left 1012073796 6:94657774-94657796 CCATCAGTCACTGCTTTCTCCCT No data
Right 1012073805 6:94657827-94657849 AGGACCACTGCCATTGGTAGGGG No data
1012073796_1012073801 10 Left 1012073796 6:94657774-94657796 CCATCAGTCACTGCTTTCTCCCT No data
Right 1012073801 6:94657807-94657829 CACAGATTTCTCAACACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012073796 Original CRISPR AGGGAGAAAGCAGTGACTGA TGG (reversed) Intergenic
No off target data available for this crispr