ID: 1012075270

View in Genome Browser
Species Human (GRCh38)
Location 6:94674779-94674801
Sequence TGTCTAATATTGACAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012075270_1012075275 13 Left 1012075270 6:94674779-94674801 CCCCCCACTGTCAATATTAGACA No data
Right 1012075275 6:94674815-94674837 AAATATTAACAATGATTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012075270 Original CRISPR TGTCTAATATTGACAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr