ID: 1012082220

View in Genome Browser
Species Human (GRCh38)
Location 6:94774470-94774492
Sequence CAATACTCCTTGCCCAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012082217_1012082220 -6 Left 1012082217 6:94774453-94774475 CCCTCACTTCCTGTTCTCAATAC No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data
1012082216_1012082220 -5 Left 1012082216 6:94774452-94774474 CCCCTCACTTCCTGTTCTCAATA No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data
1012082211_1012082220 28 Left 1012082211 6:94774419-94774441 CCCAAAATGTTCCTTGTGTCTTT No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data
1012082212_1012082220 27 Left 1012082212 6:94774420-94774442 CCAAAATGTTCCTTGTGTCTTTG No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data
1012082215_1012082220 -4 Left 1012082215 6:94774451-94774473 CCCCCTCACTTCCTGTTCTCAAT No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data
1012082213_1012082220 17 Left 1012082213 6:94774430-94774452 CCTTGTGTCTTTGATTCCTTTCC No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data
1012082218_1012082220 -7 Left 1012082218 6:94774454-94774476 CCTCACTTCCTGTTCTCAATACT No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data
1012082214_1012082220 1 Left 1012082214 6:94774446-94774468 CCTTTCCCCCTCACTTCCTGTTC No data
Right 1012082220 6:94774470-94774492 CAATACTCCTTGCCCAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012082220 Original CRISPR CAATACTCCTTGCCCAATTC AGG Intergenic
No off target data available for this crispr