ID: 1012095606

View in Genome Browser
Species Human (GRCh38)
Location 6:94954876-94954898
Sequence CTGTAGATCCAGTTGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012095603_1012095606 21 Left 1012095603 6:94954832-94954854 CCATACTGAGGATTTTAATGATT No data
Right 1012095606 6:94954876-94954898 CTGTAGATCCAGTTGTGTCTGGG No data
1012095602_1012095606 24 Left 1012095602 6:94954829-94954851 CCTCCATACTGAGGATTTTAATG No data
Right 1012095606 6:94954876-94954898 CTGTAGATCCAGTTGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012095606 Original CRISPR CTGTAGATCCAGTTGTGTCT GGG Intergenic
No off target data available for this crispr