ID: 1012103312

View in Genome Browser
Species Human (GRCh38)
Location 6:95120120-95120142
Sequence AATGTCAGATCAGCCAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012103312_1012103313 -7 Left 1012103312 6:95120120-95120142 CCTTTATTGGCTGATCTGACATT No data
Right 1012103313 6:95120136-95120158 TGACATTCCCTCAGCTCTTGAGG No data
1012103312_1012103314 -3 Left 1012103312 6:95120120-95120142 CCTTTATTGGCTGATCTGACATT No data
Right 1012103314 6:95120140-95120162 ATTCCCTCAGCTCTTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012103312 Original CRISPR AATGTCAGATCAGCCAATAA AGG (reversed) Intergenic
No off target data available for this crispr