ID: 1012103313

View in Genome Browser
Species Human (GRCh38)
Location 6:95120136-95120158
Sequence TGACATTCCCTCAGCTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012103312_1012103313 -7 Left 1012103312 6:95120120-95120142 CCTTTATTGGCTGATCTGACATT No data
Right 1012103313 6:95120136-95120158 TGACATTCCCTCAGCTCTTGAGG No data
1012103311_1012103313 0 Left 1012103311 6:95120113-95120135 CCAGGAGCCTTTATTGGCTGATC No data
Right 1012103313 6:95120136-95120158 TGACATTCCCTCAGCTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012103313 Original CRISPR TGACATTCCCTCAGCTCTTG AGG Intergenic
No off target data available for this crispr