ID: 1012108565

View in Genome Browser
Species Human (GRCh38)
Location 6:95197717-95197739
Sequence GTCATGTTACTGGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012108565_1012108574 25 Left 1012108565 6:95197717-95197739 CCACCAAAGCCCAGTAACATGAC No data
Right 1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG No data
1012108565_1012108571 18 Left 1012108565 6:95197717-95197739 CCACCAAAGCCCAGTAACATGAC No data
Right 1012108571 6:95197758-95197780 GGAGAGTAGTTATCTGCAGAAGG 0: 5
1: 4
2: 12
3: 18
4: 225
1012108565_1012108575 26 Left 1012108565 6:95197717-95197739 CCACCAAAGCCCAGTAACATGAC No data
Right 1012108575 6:95197766-95197788 GTTATCTGCAGAAGGTGGGAGGG No data
1012108565_1012108570 -3 Left 1012108565 6:95197717-95197739 CCACCAAAGCCCAGTAACATGAC No data
Right 1012108570 6:95197737-95197759 GACAGGAGCTGTTTCTCGAAAGG No data
1012108565_1012108572 21 Left 1012108565 6:95197717-95197739 CCACCAAAGCCCAGTAACATGAC No data
Right 1012108572 6:95197761-95197783 GAGTAGTTATCTGCAGAAGGTGG 0: 4
1: 183
2: 191
3: 113
4: 294
1012108565_1012108573 22 Left 1012108565 6:95197717-95197739 CCACCAAAGCCCAGTAACATGAC No data
Right 1012108573 6:95197762-95197784 AGTAGTTATCTGCAGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012108565 Original CRISPR GTCATGTTACTGGGCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr