ID: 1012108574

View in Genome Browser
Species Human (GRCh38)
Location 6:95197765-95197787
Sequence AGTTATCTGCAGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012108568_1012108574 16 Left 1012108568 6:95197726-95197748 CCCAGTAACATGACAGGAGCTGT No data
Right 1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG No data
1012108566_1012108574 22 Left 1012108566 6:95197720-95197742 CCAAAGCCCAGTAACATGACAGG No data
Right 1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG No data
1012108565_1012108574 25 Left 1012108565 6:95197717-95197739 CCACCAAAGCCCAGTAACATGAC No data
Right 1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG No data
1012108569_1012108574 15 Left 1012108569 6:95197727-95197749 CCAGTAACATGACAGGAGCTGTT No data
Right 1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012108574 Original CRISPR AGTTATCTGCAGAAGGTGGG AGG Intergenic
No off target data available for this crispr