ID: 1012119007

View in Genome Browser
Species Human (GRCh38)
Location 6:95340059-95340081
Sequence CTACACATAGGCAAATCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119007_1012119015 20 Left 1012119007 6:95340059-95340081 CCTCTAGATTTGCCTATGTGTAG No data
Right 1012119015 6:95340102-95340124 ATCATAGTCTTTGCCCAGGAAGG No data
1012119007_1012119018 27 Left 1012119007 6:95340059-95340081 CCTCTAGATTTGCCTATGTGTAG No data
Right 1012119018 6:95340109-95340131 TCTTTGCCCAGGAAGGGTCTGGG No data
1012119007_1012119016 21 Left 1012119007 6:95340059-95340081 CCTCTAGATTTGCCTATGTGTAG No data
Right 1012119016 6:95340103-95340125 TCATAGTCTTTGCCCAGGAAGGG No data
1012119007_1012119017 26 Left 1012119007 6:95340059-95340081 CCTCTAGATTTGCCTATGTGTAG No data
Right 1012119017 6:95340108-95340130 GTCTTTGCCCAGGAAGGGTCTGG No data
1012119007_1012119014 16 Left 1012119007 6:95340059-95340081 CCTCTAGATTTGCCTATGTGTAG No data
Right 1012119014 6:95340098-95340120 CTGCATCATAGTCTTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119007 Original CRISPR CTACACATAGGCAAATCTAG AGG (reversed) Intergenic
No off target data available for this crispr