ID: 1012119010

View in Genome Browser
Species Human (GRCh38)
Location 6:95340071-95340093
Sequence GCCCTCTCTGCTCTACACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119010_1012119014 4 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119014 6:95340098-95340120 CTGCATCATAGTCTTTGCCCAGG No data
1012119010_1012119018 15 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119018 6:95340109-95340131 TCTTTGCCCAGGAAGGGTCTGGG No data
1012119010_1012119016 9 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119016 6:95340103-95340125 TCATAGTCTTTGCCCAGGAAGGG No data
1012119010_1012119021 23 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119021 6:95340117-95340139 CAGGAAGGGTCTGGGAGCTCAGG No data
1012119010_1012119015 8 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119015 6:95340102-95340124 ATCATAGTCTTTGCCCAGGAAGG No data
1012119010_1012119017 14 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119017 6:95340108-95340130 GTCTTTGCCCAGGAAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119010 Original CRISPR GCCCTCTCTGCTCTACACAT AGG (reversed) Intergenic