ID: 1012119011

View in Genome Browser
Species Human (GRCh38)
Location 6:95340093-95340115
Sequence GCAAAGACTATGATGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119011_1012119021 1 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119021 6:95340117-95340139 CAGGAAGGGTCTGGGAGCTCAGG No data
1012119011_1012119024 22 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119024 6:95340138-95340160 GGCTGCTGAACCAGGCAAGTGGG No data
1012119011_1012119017 -8 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119017 6:95340108-95340130 GTCTTTGCCCAGGAAGGGTCTGG No data
1012119011_1012119022 14 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119022 6:95340130-95340152 GGAGCTCAGGCTGCTGAACCAGG No data
1012119011_1012119018 -7 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119018 6:95340109-95340131 TCTTTGCCCAGGAAGGGTCTGGG No data
1012119011_1012119023 21 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119011 Original CRISPR GCAAAGACTATGATGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr