ID: 1012119013

View in Genome Browser
Species Human (GRCh38)
Location 6:95340097-95340119
Sequence CTGGGCAAAGACTATGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119013_1012119022 10 Left 1012119013 6:95340097-95340119 CCTGCATCATAGTCTTTGCCCAG No data
Right 1012119022 6:95340130-95340152 GGAGCTCAGGCTGCTGAACCAGG No data
1012119013_1012119021 -3 Left 1012119013 6:95340097-95340119 CCTGCATCATAGTCTTTGCCCAG No data
Right 1012119021 6:95340117-95340139 CAGGAAGGGTCTGGGAGCTCAGG No data
1012119013_1012119024 18 Left 1012119013 6:95340097-95340119 CCTGCATCATAGTCTTTGCCCAG No data
Right 1012119024 6:95340138-95340160 GGCTGCTGAACCAGGCAAGTGGG No data
1012119013_1012119023 17 Left 1012119013 6:95340097-95340119 CCTGCATCATAGTCTTTGCCCAG No data
Right 1012119023 6:95340137-95340159 AGGCTGCTGAACCAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119013 Original CRISPR CTGGGCAAAGACTATGATGC AGG (reversed) Intergenic
No off target data available for this crispr