ID: 1012119013 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:95340097-95340119 |
Sequence | CTGGGCAAAGACTATGATGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012119013_1012119022 | 10 | Left | 1012119013 | 6:95340097-95340119 | CCTGCATCATAGTCTTTGCCCAG | No data | ||
Right | 1012119022 | 6:95340130-95340152 | GGAGCTCAGGCTGCTGAACCAGG | No data | ||||
1012119013_1012119021 | -3 | Left | 1012119013 | 6:95340097-95340119 | CCTGCATCATAGTCTTTGCCCAG | No data | ||
Right | 1012119021 | 6:95340117-95340139 | CAGGAAGGGTCTGGGAGCTCAGG | No data | ||||
1012119013_1012119024 | 18 | Left | 1012119013 | 6:95340097-95340119 | CCTGCATCATAGTCTTTGCCCAG | No data | ||
Right | 1012119024 | 6:95340138-95340160 | GGCTGCTGAACCAGGCAAGTGGG | No data | ||||
1012119013_1012119023 | 17 | Left | 1012119013 | 6:95340097-95340119 | CCTGCATCATAGTCTTTGCCCAG | No data | ||
Right | 1012119023 | 6:95340137-95340159 | AGGCTGCTGAACCAGGCAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012119013 | Original CRISPR | CTGGGCAAAGACTATGATGC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |