ID: 1012119016

View in Genome Browser
Species Human (GRCh38)
Location 6:95340103-95340125
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119007_1012119016 21 Left 1012119007 6:95340059-95340081 CCTCTAGATTTGCCTATGTGTAG No data
Right 1012119016 6:95340103-95340125 TCATAGTCTTTGCCCAGGAAGGG No data
1012119010_1012119016 9 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119016 6:95340103-95340125 TCATAGTCTTTGCCCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119016 Original CRISPR TCATAGTCTTTGCCCAGGAA GGG Intergenic
No off target data available for this crispr