ID: 1012119018

View in Genome Browser
Species Human (GRCh38)
Location 6:95340109-95340131
Sequence TCTTTGCCCAGGAAGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012119010_1012119018 15 Left 1012119010 6:95340071-95340093 CCTATGTGTAGAGCAGAGAGGGC No data
Right 1012119018 6:95340109-95340131 TCTTTGCCCAGGAAGGGTCTGGG No data
1012119012_1012119018 -10 Left 1012119012 6:95340096-95340118 CCCTGCATCATAGTCTTTGCCCA No data
Right 1012119018 6:95340109-95340131 TCTTTGCCCAGGAAGGGTCTGGG No data
1012119011_1012119018 -7 Left 1012119011 6:95340093-95340115 CCTCCCTGCATCATAGTCTTTGC No data
Right 1012119018 6:95340109-95340131 TCTTTGCCCAGGAAGGGTCTGGG No data
1012119007_1012119018 27 Left 1012119007 6:95340059-95340081 CCTCTAGATTTGCCTATGTGTAG No data
Right 1012119018 6:95340109-95340131 TCTTTGCCCAGGAAGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012119018 Original CRISPR TCTTTGCCCAGGAAGGGTCT GGG Intergenic
No off target data available for this crispr